AIF1 Rabbit Polyclonal Antibody
AIF1 Polyclonal Antibody |
ABP57733-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AIF1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein |
AIF1 Polyclonal Antibody |
ABP57733-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AIF1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein |
AIF1 Polyclonal Antibody |
ES11111-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AIF1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AIF1 Polyclonal Antibody |
ES11111-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AIF1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
DLR-AIF1-Hu-48T |
DL Develop |
48T |
EUR 404 |
- Should the Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
DLR-AIF1-Hu-96T |
DL Develop |
96T |
EUR 518 |
- Should the Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
DLR-AIF1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
DLR-AIF1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
DLR-AIF1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
DLR-AIF1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RD-AIF1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 393 |
Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RD-AIF1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 541 |
Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RD-AIF1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RD-AIF1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RD-AIF1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RD-AIF1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RDR-AIF1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 411 |
Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RDR-AIF1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 565 |
Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RDR-AIF1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RDR-AIF1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RDR-AIF1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
RDR-AIF1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Polyclonal AIF1 / IBA1 Antibody (Internal) |
APG01628G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIF1 / IBA1 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal AIF1 Antibody (N-term) |
APR07052G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIF1 (N-term). This antibody is tested and proven to work in the following applications: |
Aif1 Polyclonal Antibody, HRP Conjugated |
A62067 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Aif1 Polyclonal Antibody, FITC Conjugated |
A62068 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Aif1 Polyclonal Antibody, Biotin Conjugated |
A62069 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Aif1 Polyclonal Antibody, HRP Conjugated |
A56195 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Aif1 Polyclonal Antibody, FITC Conjugated |
A56196 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Aif1 Polyclonal Antibody, Biotin Conjugated |
A56197 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
AIF1 Polyclonal Antibody, HRP Conjugated |
A55284 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
AIF1 Polyclonal Antibody, FITC Conjugated |
A55285 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
AIF1 Polyclonal Antibody, Biotin Conjugated |
A55286 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Rabbit AIF1 ELISA Kit |
ERTA0634 |
Abclonal |
96Tests |
EUR 521 |
AIF1 antibody |
22709-100ul |
SAB |
100ul |
EUR 390 |
AIF1 Antibody |
31086-100ul |
SAB |
100ul |
EUR 252 |
AIF1 Antibody |
31086-50ul |
SAB |
50ul |
EUR 187 |
AIF1 antibody |
70R-12482 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal AIF1 antibody |
AIF1 antibody |
70R-14261 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal AIF1 antibody |
AIF1 antibody |
38248-100ul |
SAB |
100ul |
EUR 252 |
AIF1 antibody |
38603-100ul |
SAB |
100ul |
EUR 252 |
AIF1 Antibody |
1-CSB-PA001490GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
Aif1 Antibody |
1-CSB-PA001490HA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
Aif1 Antibody |
1-CSB-PA001490HA01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
AIF1 Antibody |
1-CSB-PA970771 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
AIF1 Antibody |
DF6442 |
Affbiotech |
200ul |
EUR 304 |
Description: AIF1 Antibody detects endogenous levels of total AIF1. |
AIF1 Antibody |
DF7217 |
Affbiotech |
200ul |
EUR 304 |
Description: AIF1 Antibody detects endogenous levels of total AIF1. |
AIF1 Antibody |
1-CSB-PA149571 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
AIF1 Antibody |
1-CSB-PA00667A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Polyclonal AIF1 / IBA1 Antibody (C-Terminus) |
APG01627G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIF1 / IBA1 (C-Terminus). This antibody is tested and proven to work in the following applications: |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNUB1909-100 |
Biotium |
100uL |
EUR 264 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Concentration: 0.2mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNUB1909-50 |
Biotium |
50uL |
EUR 405 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), 1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNUB1909-500 |
Biotium |
500uL |
EUR 513 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Concentration: 0.2mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC551909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF555 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC551909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF555 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC611909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF660R conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC611909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF660R conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC471909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF647 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC471909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF647 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC041909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405S conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC041909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405S conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC051909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405M conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC051909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405M conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC401909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF640R conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC401909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF640R conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC431909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF543 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC431909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF543 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC701909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF770 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC701909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF770 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC801909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC801909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCH1909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCH1909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCP1909-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), PerCP conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCR1909-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), RPE conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC941909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF594 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC941909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF594 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCA1909-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), APC conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCB1909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Biotin conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCB1909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Biotin conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC881909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF488A conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC881909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF488A conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC681909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF568 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC681909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF568 conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCAP1909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNCAP1909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC811909-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680R conjugate, Concentration: 0.1mg/mL |
AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody |
BNC811909-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680R conjugate, Concentration: 0.1mg/mL |
AIF1 Conjugated Antibody |
C31086 |
SAB |
100ul |
EUR 397 |
AIF1 Conjugated Antibody |
C38248 |
SAB |
100ul |
EUR 397 |
anti- AIF1 antibody |
FNab09944 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- Immunogen: allograft inflammatory factor 1
- Uniprot ID: P55008
- Gene ID: 199
- Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience, Stem Cells, Immunology
|
Description: Antibody raised against AIF1 |
Anti-AIF1 antibody |
STJ114929 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. |
Anti-AIF1 antibody |
STJ22554 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. |
Anti-AIF1 antibody |
STJ192269 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AIF1 |
AIF1 siRNA |
20-abx900236 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AIF1 siRNA |
20-abx907087 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AIF1 siRNA |
20-abx907088 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aif1 Antibody, HRP conjugated |
1-CSB-PA001490HB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Aif1 Antibody, HRP conjugated |
1-CSB-PA001490HB01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA |
Aif1 Antibody, FITC conjugated |
1-CSB-PA001490HC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Aif1 Antibody, FITC conjugated |
1-CSB-PA001490HC01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA |
Aif1 Antibody, Biotin conjugated |
1-CSB-PA001490HD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Aif1 Antibody, Biotin conjugated |
1-CSB-PA001490HD01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA |
AIF1 Antibody, HRP conjugated |
1-CSB-PA00667B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AIF1 Antibody, FITC conjugated |
1-CSB-PA00667C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AIF1 Antibody, Biotin conjugated |
1-CSB-PA00667D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-Iba1/AIF1 Antibody |
A01394 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Iba1/AIF1 Antibody |
PA1724 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Iba1/AIF1 Antibody |
RP1074 |
BosterBio |
100ug/vial |
EUR 334 |
Polyclonal Goat Anti-AIF1 / IBA1 (isoform 3) Antibody |
AMM04873G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoform 3) . This antibody is tested and proven to work in the following applications: |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human) |
4-PAC288Hu01 |
Cloud-Clone |
-
EUR 203.00
-
EUR 1823.00
-
EUR 469.00
-
EUR 247.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1) |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse) |
4-PAC288Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1) |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat) |
4-PAC288Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1) |
Polyclonal Goat Anti-AIF1 / IBA1 (isoforms 1 + 3) Antibody |
AMM04874G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoforms 1 + 3) . This antibody is tested and proven to work in the following applications: |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig) |
4-PAC288Gu01 |
Cloud-Clone |
-
EUR 268.00
-
EUR 2840.00
-
EUR 700.00
-
EUR 340.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1) |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), APC |
4-PAC288Hu01-APC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2339.00
-
EUR 678.00
-
EUR 346.00
-
EUR 191.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), Biotinylated |
4-PAC288Hu01-Biotin |
Cloud-Clone |
-
EUR 263.00
-
EUR 1773.00
-
EUR 555.00
-
EUR 312.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), Cy3 |
4-PAC288Hu01-Cy3 |
Cloud-Clone |
-
EUR 331.00
-
EUR 3077.00
-
EUR 863.00
-
EUR 420.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), FITC |
4-PAC288Hu01-FITC |
Cloud-Clone |
-
EUR 243.00
-
EUR 1891.00
-
EUR 562.00
-
EUR 297.00
-
EUR 173.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), HRP |
4-PAC288Hu01-HRP |
Cloud-Clone |
-
EUR 259.00
-
EUR 2043.00
-
EUR 604.00
-
EUR 316.00
-
EUR 182.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), PE |
4-PAC288Hu01-PE |
Cloud-Clone |
-
EUR 243.00
-
EUR 1891.00
-
EUR 562.00
-
EUR 297.00
-
EUR 173.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), APC |
4-PAC288Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC288Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), Cy3 |
4-PAC288Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), FITC |
4-PAC288Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), HRP |
4-PAC288Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), PE |
4-PAC288Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), APC |
4-PAC288Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), Biotinylated |
4-PAC288Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), Cy3 |
4-PAC288Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), FITC |
4-PAC288Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), HRP |
4-PAC288Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), PE |
4-PAC288Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE. |
AIF1 Blocking Peptide |
DF6442-BP |
Affbiotech |
1mg |
EUR 195 |
AIF1 Blocking Peptide |
DF7217-BP |
Affbiotech |
1mg |
EUR 195 |
AIF1 cloning plasmid |
CSB-CL001490HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 444
- Sequence: atgagccaaaccagggatttacagggaggaaaagctttcggactgctgaaggcccagcaggaagagaggctggatgagatcaacaagcaattcctagacgatcccaaatatagcagtgatgaggatctgccctccaaactggaaggcttcaaagagaaatacatggagtttgacct
- Show more
|
Description: A cloning plasmid for the AIF1 gene. |
Rabbit Allograft Inflammatory Factor 1 (AIF1) ELISA Kit |
abx362615-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Polyclonal Goat Anti-AIF1 / IBA1 (isoform 1 and 3) Antibody |
AMM04872G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoform 1 and 3) . This antibody is tested and proven to work in the following applications: |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), APC |
4-PAC288Gu01-APC |
Cloud-Clone |
-
EUR 377.00
-
EUR 3725.00
-
EUR 1025.00
-
EUR 485.00
-
EUR 233.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), Biotinylated |
4-PAC288Gu01-Biotin |
Cloud-Clone |
-
EUR 334.00
-
EUR 2790.00
-
EUR 810.00
-
EUR 414.00
-
EUR 229.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), Cy3 |
4-PAC288Gu01-Cy3 |
Cloud-Clone |
-
EUR 461.00
-
EUR 4925.00
-
EUR 1325.00
-
EUR 605.00
-
EUR 269.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), FITC |
4-PAC288Gu01-FITC |
Cloud-Clone |
-
EUR 321.00
-
EUR 3000.00
-
EUR 840.00
-
EUR 408.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), HRP |
4-PAC288Gu01-HRP |
Cloud-Clone |
-
EUR 343.00
-
EUR 3245.00
-
EUR 905.00
-
EUR 437.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), PE |
4-PAC288Gu01-PE |
Cloud-Clone |
-
EUR 321.00
-
EUR 3000.00
-
EUR 840.00
-
EUR 408.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC288Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 439.00
-
EUR 4558.00
-
EUR 1237.00
-
EUR 572.00
-
EUR 263.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC288Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Pro35~Glu130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7. |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC288Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7. |
AIF1/ Iba1 MonoSpecific Antibody, Unconjugated-20ug |
199-MSM1-P0 |
EnQuireBio |
20ug |
EUR 233 |
AIF1/ Iba1 MonoSpecific Antibody, Unconjugated-100ug |
199-MSM1-P1 |
EnQuireBio |
100ug |
EUR 428 |
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx025719-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx025719-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx214166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx214538 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx175326 |
Abbexa |
-
EUR 328.00
-
EUR 133.00
-
EUR 899.00
-
EUR 453.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx175327 |
Abbexa |
|
|
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103213 |
Abbexa |
-
EUR 328.00
-
EUR 133.00
-
EUR 899.00
-
EUR 453.00
-
EUR 286.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103214 |
Abbexa |
-
EUR 300.00
-
EUR 704.00
-
EUR 356.00
-
EUR 154.00
-
EUR 244.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103215 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 829.00
-
EUR 439.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx103216 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx104925 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1358.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx110941 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx037687-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
abx037794-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx131921 |
Abbexa |
-
EUR 356.00
-
EUR 913.00
-
EUR 467.00
-
EUR 154.00
-
EUR 272.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx109254 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx109516 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (Aif1) Antibody |
20-abx319635 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody |
20-abx001285 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
AIF1 protein (His tag) |
80R-1764 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human AIF1 protein |
Human AIF1 ELISA Kit |
EHA0634 |
Abclonal |
96Tests |
EUR 521 |
Goat AIF1 ELISA Kit |
EGTA0634 |
Abclonal |
96Tests |
EUR 521 |
Canine AIF1 ELISA Kit |
ECA0634 |
Abclonal |
96Tests |
EUR 521 |
Chicken AIF1 ELISA Kit |
ECKA0634 |
Abclonal |
96Tests |
EUR 521 |
Anserini AIF1 ELISA Kit |
EAA0634 |
Abclonal |
96Tests |
EUR 521 |
Bovine AIF1 ELISA Kit |
EBA0634 |
Abclonal |
96Tests |
EUR 521 |
Rat AIF1 shRNA Plasmid |
20-abx985490 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AIF1 shRNA Plasmid |
20-abx950138 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AIF1 shRNA Plasmid |
20-abx969091 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AIF1 ELISA Kit |
EMA0634 |
Abclonal |
96Tests |
EUR 521 |
Rat AIF1 ELISA Kit |
ERA0634 |
Abclonal |
96Tests |
EUR 521 |
Sheep AIF1 ELISA Kit |
ESA0634 |
Abclonal |
96Tests |
EUR 521 |
Monkey AIF1 ELISA Kit |
EMKA0634 |
Abclonal |
96Tests |
EUR 521 |
Porcine AIF1 ELISA Kit |
EPA0634 |
Abclonal |
96Tests |
EUR 521 |
AIF1 Recombinant Protein (Human) |
RP000835 |
ABM |
100 ug |
Ask for price |
AIF1 Recombinant Protein (Mouse) |
RP115022 |
ABM |
100 ug |
Ask for price |
AIF1 Recombinant Protein (Rat) |
RP189626 |
ABM |
100 ug |
Ask for price |
Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), APC-Cy7 |
4-PAC288Gu01-APC-Cy7 |
Cloud-Clone |
-
EUR 634.00
-
EUR 7330.00
-
EUR 1930.00
-
EUR 850.00
-
EUR 346.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AIF1 (Met1~Pro147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7. |
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx105119 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin) |
20-abx105120 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC) |
20-abx106536 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC) |
20-abx106537 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP) |
20-abx107953 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP) |
20-abx107954 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
AIF1 / Iba1 (Microglia Marker) (rAIF1/1909) Antibody |
BNCR2346-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (rAIF1/1909), RPE conjugate, Concentration: 0.1mg/mL |
AIF1 Rabbit Polyclonal Antibody