AIF1 Rabbit Polyclonal Antibody

AIF1 Rabbit Polyclonal Antibody

AIF1 Polyclonal Antibody
ABP57733-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human AIF1 protein Applications tips:
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein

AIF1 Polyclonal Antibody
ABP57733-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human AIF1 protein Applications tips:
Description: A polyclonal antibody for detection of AIF1 from Human, Mouse, Rat. This AIF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AIF1 protein

AIF1 Polyclonal Antibody
ES11111-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against AIF1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AIF1 Polyclonal Antibody
ES11111-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against AIF1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
DLR-AIF1-Hu-48T	DL Develop	48T	EUR 404
Should the Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
DLR-AIF1-Hu-96T	DL Develop	96T	EUR 518
Should the Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
DLR-AIF1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
DLR-AIF1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
DLR-AIF1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
DLR-AIF1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Allograft Inflammatory Factor 1 (AIF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RD-AIF1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 393

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RD-AIF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 541

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RD-AIF1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RD-AIF1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RD-AIF1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RD-AIF1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RDR-AIF1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 411

Human Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RDR-AIF1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 565

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RDR-AIF1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RDR-AIF1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RDR-AIF1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
RDR-AIF1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Polyclonal AIF1 / IBA1 Antibody (Internal)
APG01628G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIF1 / IBA1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal AIF1 Antibody (N-term)
APR07052G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AIF1 (N-term). This antibody is tested and proven to work in the following applications:

Aif1 Polyclonal Antibody, HRP Conjugated
A62067	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Aif1 Polyclonal Antibody, FITC Conjugated
A62068	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Aif1 Polyclonal Antibody, Biotin Conjugated
A62069	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Aif1 Polyclonal Antibody, HRP Conjugated
A56195	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Aif1 Polyclonal Antibody, FITC Conjugated
A56196	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Aif1 Polyclonal Antibody, Biotin Conjugated
A56197	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

AIF1 Polyclonal Antibody, HRP Conjugated
A55284	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

AIF1 Polyclonal Antibody, FITC Conjugated
A55285	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

AIF1 Polyclonal Antibody, Biotin Conjugated
A55286	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Rabbit AIF1 ELISA Kit
ERTA0634	Abclonal	96Tests	EUR 521

AIF1 antibody
22709-100ul	SAB	100ul	EUR 390

AIF1 Antibody
31086-100ul	SAB	100ul	EUR 252

AIF1 Antibody
31086-50ul	SAB	50ul	EUR 187

AIF1 antibody
70R-12482	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal AIF1 antibody

AIF1 antibody
70R-14261	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal AIF1 antibody

AIF1 antibody
38248-100ul	SAB	100ul	EUR 252

AIF1 antibody
38603-100ul	SAB	100ul	EUR 252

AIF1 Antibody
1-CSB-PA001490GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

Aif1 Antibody
1-CSB-PA001490HA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

Aif1 Antibody
1-CSB-PA001490HA01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

AIF1 Antibody
1-CSB-PA970771	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

AIF1 Antibody
DF6442	Affbiotech	200ul	EUR 304
Description: AIF1 Antibody detects endogenous levels of total AIF1.

AIF1 Antibody
DF7217	Affbiotech	200ul	EUR 304
Description: AIF1 Antibody detects endogenous levels of total AIF1.

AIF1 Antibody
1-CSB-PA149571	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

AIF1 Antibody
1-CSB-PA00667A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AIF1 Antibody
ABD6442	Lifescience Market	100 ug	EUR 438

AIF1 Antibody
ABD7217	Lifescience Market	100 ug	EUR 438

AIF1 antibody
PAab09944	Lifescience Market	100 ug	EUR 386

Polyclonal AIF1 / IBA1 Antibody (C-Terminus)
APG01627G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AIF1 / IBA1 (C-Terminus). This antibody is tested and proven to work in the following applications:

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNUB1909-100	Biotium	100uL	EUR 264
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Concentration: 0.2mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNUB1909-50	Biotium	50uL	EUR 405
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), 1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNUB1909-500	Biotium	500uL	EUR 513
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Concentration: 0.2mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC551909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF555 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC551909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF555 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC611909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF660R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC611909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF660R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC471909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF647 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC471909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF647 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC041909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405S conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC041909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405S conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC051909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405M conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC051909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF405M conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC401909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF640R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC401909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF640R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC431909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF543 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC431909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF543 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC701909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF770 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC701909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF770 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC801909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC801909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCH1909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCH1909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCP1909-250	Biotium	250uL	EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), PerCP conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCR1909-250	Biotium	250uL	EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), RPE conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC941909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF594 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC941909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF594 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCA1909-250	Biotium	250uL	EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), APC conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCB1909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Biotin conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCB1909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Biotin conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC881909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF488A conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC881909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF488A conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC681909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF568 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC681909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF568 conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCAP1909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNCAP1909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC811909-100	Biotium	100uL	EUR 233
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680R conjugate, Concentration: 0.1mg/mL

AIF1 / Iba1 (Microglia Marker) (AIF1/1909) Antibody
BNC811909-500	Biotium	500uL	EUR 545
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (AIF1/1909), CF680R conjugate, Concentration: 0.1mg/mL

AIF1 Conjugated Antibody
C31086	SAB	100ul	EUR 397

AIF1 Conjugated Antibody
C38248	SAB	100ul	EUR 397

anti- AIF1 antibody
FNab09944	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: allograft inflammatory factor 1 Uniprot ID: P55008 Gene ID: 199 Research Area: Signal Transduction, Metabolism, Cardiovascular, Developmental biology, Neuroscience, Stem Cells, Immunology
Description: Antibody raised against AIF1

anti- AIF1 antibody
LSMab09944	Lifescience Market	100 ug	EUR 386

Anti-AIF1 antibody
STJ114929	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain.

Anti-AIF1 antibody
STJ22554	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain.

Anti-AIF1 antibody
STJ192269	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to AIF1

Aif1/ Rat Aif1 ELISA Kit
ELI-04139r	Lifescience Market	96 Tests	EUR 886

Goat Anti Aif1 (C-Terminal) Polyclonal Antibody
CPBT-65002GA	Creative Diagnostics	0.1 mg	EUR 840

AIF1 siRNA
20-abx900236	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AIF1 siRNA
20-abx907087	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

AIF1 siRNA
20-abx907088	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Aif1 Antibody, HRP conjugated
1-CSB-PA001490HB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Aif1 Antibody, HRP conjugated
1-CSB-PA001490HB01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Aif1 Antibody, FITC conjugated
1-CSB-PA001490HC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Aif1 Antibody, FITC conjugated
1-CSB-PA001490HC01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Aif1 Antibody, Biotin conjugated
1-CSB-PA001490HD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Aif1 Antibody, Biotin conjugated
1-CSB-PA001490HD01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Aif1. Recognizes Aif1 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

AIF1 Antibody, HRP conjugated
1-CSB-PA00667B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AIF1 Antibody, FITC conjugated
1-CSB-PA00667C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AIF1 Antibody, Biotin conjugated
1-CSB-PA00667D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AIF1. Recognizes AIF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Iba1/AIF1 Antibody
A01394	BosterBio	100ug/vial	EUR 334

Anti-Iba1/AIF1 Antibody
PA1724	BosterBio	100ug/vial	EUR 334

Anti-Iba1/AIF1 Antibody
RP1074	BosterBio	100ug/vial	EUR 334

Polyclonal Goat Anti-AIF1 / IBA1 (isoform 3) Antibody
AMM04873G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoform 3) . This antibody is tested and proven to work in the following applications:

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human)
4-PAC288Hu01	Cloud-Clone	EUR 203.00 EUR 1823.00 EUR 469.00 EUR 247.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1)

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse)
4-PAC288Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1)

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat)
4-PAC288Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1)

Polyclonal Goat Anti-AIF1 / IBA1 (isoforms 1 + 3) Antibody
AMM04874G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoforms 1 + 3) . This antibody is tested and proven to work in the following applications:

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig)
4-PAC288Gu01	Cloud-Clone	EUR 268.00 EUR 2840.00 EUR 700.00 EUR 340.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1)

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), APC
4-PAC288Hu01-APC	Cloud-Clone	EUR 279.00 EUR 2339.00 EUR 678.00 EUR 346.00 EUR 191.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), Biotinylated
4-PAC288Hu01-Biotin	Cloud-Clone	EUR 263.00 EUR 1773.00 EUR 555.00 EUR 312.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), Cy3
4-PAC288Hu01-Cy3	Cloud-Clone	EUR 331.00 EUR 3077.00 EUR 863.00 EUR 420.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), FITC
4-PAC288Hu01-FITC	Cloud-Clone	EUR 243.00 EUR 1891.00 EUR 562.00 EUR 297.00 EUR 173.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), HRP
4-PAC288Hu01-HRP	Cloud-Clone	EUR 259.00 EUR 2043.00 EUR 604.00 EUR 316.00 EUR 182.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), PE
4-PAC288Hu01-PE	Cloud-Clone	EUR 243.00 EUR 1891.00 EUR 562.00 EUR 297.00 EUR 173.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), APC
4-PAC288Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC288Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), Cy3
4-PAC288Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), FITC
4-PAC288Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), HRP
4-PAC288Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), PE
4-PAC288Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), APC
4-PAC288Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), Biotinylated
4-PAC288Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), Cy3
4-PAC288Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), FITC
4-PAC288Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), HRP
4-PAC288Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), PE
4-PAC288Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

AIF1 Blocking Peptide
DF6442-BP	Affbiotech	1mg	EUR 195

AIF1 Blocking Peptide
DF7217-BP	Affbiotech	1mg	EUR 195

AIF1 cloning plasmid
CSB-CL001490HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 444 Sequence: atgagccaaaccagggatttacagggaggaaaagctttcggactgctgaaggcccagcaggaagagaggctggatgagatcaacaagcaattcctagacgatcccaaatatagcagtgatgaggatctgccctccaaactggaaggcttcaaagagaaatacatggagtttgacct Show more
Description: A cloning plasmid for the AIF1 gene.

Rabbit Allograft Inflammatory Factor 1 (AIF1) ELISA Kit
abx362615-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Polyclonal Goat Anti-AIF1 / IBA1 (isoform 1 and 3) Antibody
AMM04872G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AIF1 / IBA1 (isoform 1 and 3) . This antibody is tested and proven to work in the following applications:

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), APC
4-PAC288Gu01-APC	Cloud-Clone	EUR 377.00 EUR 3725.00 EUR 1025.00 EUR 485.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), Biotinylated
4-PAC288Gu01-Biotin	Cloud-Clone	EUR 334.00 EUR 2790.00 EUR 810.00 EUR 414.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Biotin.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), Cy3
4-PAC288Gu01-Cy3	Cloud-Clone	EUR 461.00 EUR 4925.00 EUR 1325.00 EUR 605.00 EUR 269.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with Cy3.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), FITC
4-PAC288Gu01-FITC	Cloud-Clone	EUR 321.00 EUR 3000.00 EUR 840.00 EUR 408.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with FITC.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), HRP
4-PAC288Gu01-HRP	Cloud-Clone	EUR 343.00 EUR 3245.00 EUR 905.00 EUR 437.00 EUR 218.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with HRP.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), PE
4-PAC288Gu01-PE	Cloud-Clone	EUR 321.00 EUR 3000.00 EUR 840.00 EUR 408.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with PE.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Human), APC-Cy7
4-PAC288Hu01-APC-Cy7	Cloud-Clone	EUR 439.00 EUR 4558.00 EUR 1237.00 EUR 572.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC288Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Pro35~Glu130) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC288Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

AIF1/ Iba1 MonoSpecific Antibody, Unconjugated-20ug
199-MSM1-P0	EnQuireBio	20ug	EUR 233

AIF1/ Iba1 MonoSpecific Antibody, Unconjugated-100ug
199-MSM1-P1	EnQuireBio	100ug	EUR 428

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx025719-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx025719-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx214166	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx214538	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx175326	Abbexa	EUR 328.00 EUR 133.00 EUR 899.00 EUR 453.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx175327	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103213	Abbexa	EUR 328.00 EUR 133.00 EUR 899.00 EUR 453.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103214	Abbexa	EUR 300.00 EUR 704.00 EUR 356.00 EUR 154.00 EUR 244.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103215	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx103216	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx104925	Abbexa	EUR 467.00 EUR 133.00 EUR 1358.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx110941	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx037687-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
abx037794-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx131921	Abbexa	EUR 356.00 EUR 913.00 EUR 467.00 EUR 154.00 EUR 272.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx109254	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx109516	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (Aif1) Antibody
20-abx319635	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody
20-abx001285	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-AIF1 / IBA1 (isoform 3) antibody
STJ70888	St John's Laboratory	100 µg	EUR 359

AIF1 protein (His tag)
80R-1764	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human AIF1 protein

Human AIF1 ELISA Kit
EHA0634	Abclonal	96Tests	EUR 521

Human AIF1 ELISA Kit
ELA-E1251h	Lifescience Market	96 Tests	EUR 824

Goat AIF1 ELISA Kit
EGTA0634	Abclonal	96Tests	EUR 521

Canine AIF1 ELISA Kit
ECA0634	Abclonal	96Tests	EUR 521

Chicken AIF1 ELISA Kit
ECKA0634	Abclonal	96Tests	EUR 521

Anserini AIF1 ELISA Kit
EAA0634	Abclonal	96Tests	EUR 521

Bovine AIF1 ELISA Kit
EBA0634	Abclonal	96Tests	EUR 521

AIF1 ELISA KIT|Human
EF007245	Lifescience Market	96 Tests	EUR 689

Rat AIF1 shRNA Plasmid
20-abx985490	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human AIF1 shRNA Plasmid
20-abx950138	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse AIF1 shRNA Plasmid
20-abx969091	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse AIF1 ELISA Kit
EMA0634	Abclonal	96Tests	EUR 521

Rat AIF1 ELISA Kit
ERA0634	Abclonal	96Tests	EUR 521

Sheep AIF1 ELISA Kit
ESA0634	Abclonal	96Tests	EUR 521

Monkey AIF1 ELISA Kit
EMKA0634	Abclonal	96Tests	EUR 521

Porcine AIF1 ELISA Kit
EPA0634	Abclonal	96Tests	EUR 521

AIF1 Recombinant Protein (Human)
RP000835	ABM	100 ug	Ask for price

AIF1 Recombinant Protein (Mouse)
RP115022	ABM	100 ug	Ask for price

AIF1 Recombinant Protein (Rat)
RP189626	ABM	100 ug	Ask for price

Allograft Inflammatory Factor 1 (AIF1) Polyclonal Antibody (Guinea pig), APC-Cy7
4-PAC288Gu01-APC-Cy7	Cloud-Clone	EUR 634.00 EUR 7330.00 EUR 1930.00 EUR 850.00 EUR 346.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AIF1 (Met1~Pro147) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Guinea pig Allograft Inflammatory Factor 1 (AIF1). This antibody is labeled with APC-Cy7.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx105119	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (Biotin)
20-abx105120	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)
20-abx106536	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (FITC)
20-abx106537	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP)
20-abx107953	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Allograft Inflammatory Factor 1 (AIF1) Antibody (HRP)
20-abx107954	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

AIF1 / Iba1 (Microglia Marker) (rAIF1/1909) Antibody
BNCR2346-250	Biotium	250uL	EUR 394
Description: Primary antibody against AIF1 / Iba1 (Microglia Marker) (rAIF1/1909), RPE conjugate, Concentration: 0.1mg/mL

AIF1 Rabbit Polyclonal Antibody