셀타젠 Genetic Genotyping

AOC3 Rabbit Polyclonal Antibody

AOC3 Polyclonal Antibody

ABP57780-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AOC3 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of AOC3 from Human, Mouse, Rat. This AOC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOC3 protein at amino acid sequence of 510-590

AOC3 Polyclonal Antibody

ES11338-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AOC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AOC3 Polyclonal Antibody

ES11338-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AOC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AOC3 Rabbit pAb

A2001-100ul 100 ul
EUR 308

AOC3 Rabbit pAb

A2001-200ul 200 ul
EUR 459

AOC3 Rabbit pAb

A2001-20ul 20 ul
EUR 183

AOC3 Rabbit pAb

A2001-50ul 50 ul
EUR 223

Polyclonal AOC3 Antibody (Center)

APR11425G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AOC3 (Center). This antibody is tested and proven to work in the following applications:

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Hu-48T 48T
EUR 517
  • Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Hu-96T 96T
EUR 673
  • Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Mu-48T 48T
EUR 527
  • Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Mu-96T 96T
EUR 688
  • Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Ra-48T 48T
EUR 549
  • Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

DLR-AOC3-Ra-96T 96T
EUR 718
  • Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Hu-48Tests 48 Tests
EUR 544

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Hu-96Tests 96 Tests
EUR 756

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Mu-48Tests 48 Tests
EUR 557

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Mu-96Tests 96 Tests
EUR 774

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Ra-48Tests 48 Tests
EUR 583

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RDR-AOC3-Ra-96Tests 96 Tests
EUR 811

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Hu-48Tests 48 Tests
EUR 521

Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Hu-96Tests 96 Tests
EUR 723

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Mu-48Tests 48 Tests
EUR 533

Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Mu-96Tests 96 Tests
EUR 740

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Ra-48Tests 48 Tests
EUR 557

Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit

RD-AOC3-Ra-96Tests 96 Tests
EUR 775

AOC3 antibody

70R-15743 50 ul
EUR 435
Description: Rabbit polyclonal AOC3 antibody

AOC3 Antibody

32546-100ul 100ul
EUR 252

AOC3 Antibody

43880-100ul 100ul
EUR 252

AOC3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AOC3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

AOC3 Antibody

DF6745 200ul
EUR 304
Description: AOC3 Antibody detects endogenous levels of total AOC3.

AOC3 Antibody

ABD6745 100 ug
EUR 438

Polyclonal Goat Anti-AOC3 Antibody

APR12069G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AOC3 . This antibody is tested and proven to work in the following applications:

Polyclonal AOC3 / VAP-1 Antibody (Internal)

AMRa00049G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP-1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal AOC3 / VAP1 Antibody (internal region)

APR11424G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP1 (internal region). This antibody is tested and proven to work in the following applications:

AOC3 Conjugated Antibody

C43880 100ul
EUR 397

AOC3 Conjugated Antibody

C32546 100ul
EUR 397

Anti-AOC3 antibody

STJ22624 100 µl
EUR 277
Description: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants.

Anti-AOC3 antibody

STJ71075 100 µg
EUR 359

Anti-AOC3 antibody

STJ192496 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AOC3

Aoc3/ Rat Aoc3 ELISA Kit

ELI-03530r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AOC3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AOC3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AOC3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AOC3 / VAP1 antibody

STJ72165 100 µg
EUR 359

AOC3 Blocking Peptide

DF6745-BP 1mg
EUR 195

AOC3 cloning plasmid

CSB-CL624122HU-10ug 10ug
EUR 751
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2292
  • Sequence: atgaaccagaagacaatcctcgtgctcctcattctggccgtcatcaccatctttgccttggtttgtgtcctgctggtgggcaggggtggagatgggggtgaacccagccagcttccccattgcccctctgtatctcccagtgcccagccttggacacaccctggccagagccagc
  • Show more
Description: A cloning plasmid for the AOC3 gene.

Membrane Primary Amine Oxidase (AOC3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

abx033988-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

abx033988-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human AOC3 ELISA Kit

ELA-E1083h 96 Tests
EUR 824


EF009118 96 Tests
EUR 689

Rat AOC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AOC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AOC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AOC3 Recombinant Protein (Human)

RP001399 100 ug Ask for price

AOC3 Recombinant Protein (Mouse)

RP116186 100 ug Ask for price

AOC3 Recombinant Protein (Rat)

RP190385 100 ug Ask for price

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Membrane Primary Amine Oxidase (AOC3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Membrane Primary Amine Oxidase (AOC3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

abx430190-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Amine Oxidase, Copper Containing 3 (AOC3) Antibody

abx431095-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Aoc3 ORF Vector (Rat) (pORF)

ORF063463 1.0 ug DNA
EUR 506

AOC3 ORF Vector (Human) (pORF)

ORF000467 1.0 ug DNA
EUR 95

Aoc3 ORF Vector (Mouse) (pORF)

ORF038730 1.0 ug DNA
EUR 506

AOC3 Rabbit Polyclonal Antibody