AOC3 Rabbit Polyclonal Antibody
AOC3 Polyclonal Antibody |
ABP57780-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AOC3 protein at amino acid sequence of 510-590
- Applications tips:
|
Description: A polyclonal antibody for detection of AOC3 from Human, Mouse, Rat. This AOC3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AOC3 protein at amino acid sequence of 510-590 |
AOC3 Polyclonal Antibody |
ES11338-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AOC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AOC3 Polyclonal Antibody |
ES11338-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AOC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AOC3 Rabbit pAb |
A2001-100ul |
Abclonal |
100 ul |
EUR 308 |
AOC3 Rabbit pAb |
A2001-200ul |
Abclonal |
200 ul |
EUR 459 |
AOC3 Rabbit pAb |
A2001-20ul |
Abclonal |
20 ul |
EUR 183 |
AOC3 Rabbit pAb |
A2001-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal AOC3 Antibody (Center) |
APR11425G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AOC3 (Center). This antibody is tested and proven to work in the following applications: |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
DLR-AOC3-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Amine Oxidase, Copper Containing 3 (AOC3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RDR-AOC3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Amine Oxidase, Copper Containing 3 (AOC3) ELISA Kit |
RD-AOC3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
AOC3 antibody |
70R-15743 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal AOC3 antibody |
AOC3 Antibody |
32546-100ul |
SAB |
100ul |
EUR 252 |
AOC3 Antibody |
43880-100ul |
SAB |
100ul |
EUR 252 |
AOC3 Antibody |
1-CSB-PA001855GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
AOC3 Antibody |
1-CSB-PA624122LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
AOC3 Antibody |
DF6745 |
Affbiotech |
200ul |
EUR 304 |
Description: AOC3 Antibody detects endogenous levels of total AOC3. |
Polyclonal Goat Anti-AOC3 Antibody |
APR12069G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AOC3 . This antibody is tested and proven to work in the following applications: |
Polyclonal AOC3 / VAP-1 Antibody (Internal) |
AMRa00049G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP-1 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal AOC3 / VAP1 Antibody (internal region) |
APR11424G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human AOC3 / VAP1 (internal region). This antibody is tested and proven to work in the following applications: |
AOC3 Conjugated Antibody |
C43880 |
SAB |
100ul |
EUR 397 |
AOC3 Conjugated Antibody |
C32546 |
SAB |
100ul |
EUR 397 |
Anti-AOC3 antibody |
STJ22624 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. |
Anti-AOC3 antibody |
STJ192496 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AOC3 |
AOC3 siRNA |
20-abx900345 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOC3 siRNA |
20-abx907688 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOC3 siRNA |
20-abx907689 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AOC3 Antibody, HRP conjugated |
1-CSB-PA624122LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AOC3 Antibody, FITC conjugated |
1-CSB-PA624122LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AOC3 Antibody, Biotin conjugated |
1-CSB-PA624122LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AOC3. Recognizes AOC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
AOC3 Blocking Peptide |
DF6745-BP |
Affbiotech |
1mg |
EUR 195 |
AOC3 cloning plasmid |
CSB-CL624122HU-10ug |
Cusabio |
10ug |
EUR 751 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2292
- Sequence: atgaaccagaagacaatcctcgtgctcctcattctggccgtcatcaccatctttgccttggtttgtgtcctgctggtgggcaggggtggagatgggggtgaacccagccagcttccccattgcccctctgtatctcccagtgcccagccttggacacaccctggccagagccagc
- Show more
|
Description: A cloning plasmid for the AOC3 gene. |
Membrane Primary Amine Oxidase (AOC3) Antibody |
20-abx110946 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
abx033988-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
abx033988-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
20-abx333876 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody |
20-abx001627 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rat AOC3 shRNA Plasmid |
20-abx985523 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AOC3 shRNA Plasmid |
20-abx955678 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AOC3 shRNA Plasmid |
20-abx969153 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AOC3 Recombinant Protein (Human) |
RP001399 |
ABM |
100 ug |
Ask for price |
AOC3 Recombinant Protein (Mouse) |
RP116186 |
ABM |
100 ug |
Ask for price |
AOC3 Recombinant Protein (Rat) |
RP190385 |
ABM |
100 ug |
Ask for price |
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
20-abx175354 |
Abbexa |
|
|
|
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
20-abx175355 |
Abbexa |
|
|
|
Membrane Primary Amine Oxidase (AOC3) Antibody (HRP) |
20-abx336489 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody (FITC) |
20-abx336490 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Membrane Primary Amine Oxidase (AOC3) Antibody (Biotin) |
20-abx336491 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
abx430190-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Amine Oxidase, Copper Containing 3 (AOC3) Antibody |
abx431095-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Aoc3 ORF Vector (Rat) (pORF) |
ORF063463 |
ABM |
1.0 ug DNA |
EUR 506 |
AOC3 ORF Vector (Human) (pORF) |
ORF000467 |
ABM |
1.0 ug DNA |
EUR 95 |
Aoc3 ORF Vector (Mouse) (pORF) |
ORF038730 |
ABM |
1.0 ug DNA |
EUR 506 |
AOC3 Rabbit Polyclonal Antibody