ARC Rabbit Polyclonal Antibody
ARC Polyclonal Antibody |
ES11228-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ARC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ARC Polyclonal Antibody |
ES11228-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ARC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ARC Polyclonal Antibody |
ABP57807-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of ARC from Human, Mouse, Rat. This ARC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150 |
ARC Polyclonal Antibody |
ABP57807-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of ARC from Human, Mouse, Rat. This ARC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150 |
ARC Polyclonal Antibody |
ABP57807-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of ARC from Human, Mouse, Rat. This ARC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ARC protein at amino acid sequence of 70-150 |
ARC Rabbit pAb |
A9177-100ul |
Abclonal |
100 ul |
EUR 308 |
ARC Rabbit pAb |
A9177-200ul |
Abclonal |
200 ul |
EUR 459 |
ARC Rabbit pAb |
A9177-20ul |
Abclonal |
20 ul |
EUR 183 |
ARC Rabbit pAb |
A9177-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NOL3 / ARC Antibody |
AMM06742G |
Leading Biology |
1 ea |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL3 / ARC . This antibody is tested and proven to work in the following applications: |
Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
DLR-ARC-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
DLR-ARC-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
DLR-ARC-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
DLR-ARC-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
DLR-ARC-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates or other biological fluids. |
Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
DLR-ARC-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Activity Regulated Cytoskeleton Associated Protein (ARC) in samples from tissue homogenates or other biological fluids. |
Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RD-ARC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RD-ARC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RD-ARC-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RD-ARC-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RD-ARC-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RD-ARC-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RDR-ARC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RDR-ARC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RDR-ARC-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RDR-ARC-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RDR-ARC-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Activity Regulated Cytoskeleton Associated Protein (ARC) ELISA Kit |
RDR-ARC-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Polyclonal ARC Antibody (N-term) |
APR11458G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARC (N-term). This antibody is tested and proven to work in the following applications: |
ARC Antibody |
AF0118 |
Affbiotech |
200ul |
EUR 304 |
Description: ARC antibody detects endogenous levels of total ARC. |
ARC antibody |
70R-4422 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ARC antibody raised against the middle region of ARC |
ARC antibody |
70R-31103 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ARC antibody |
ARC antibody |
70R-8315 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ARC antibody |
ARC Antibody |
33325-100ul |
SAB |
100ul |
EUR 252 |
ARC Antibody |
33325-50ul |
SAB |
50ul |
EUR 187 |
ARC Antibody |
24052-100ul |
SAB |
100ul |
EUR 390 |
ARC Antibody |
24081-100ul |
SAB |
100ul |
EUR 390 |
ARC antibody |
70R-13932 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal ARC antibody |
ARC antibody |
70R-15785 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ARC antibody |
ARC Antibody |
1-CSB-PA906268 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ARC. Recognizes ARC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
ARC Antibody |
CSB-PA995409- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
ARC Antibody |
CSB-PA995409-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500 |
ARC Antibody |
1-CSB-PA001981GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
ARC Antibody |
1-CSB-PA786870 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200 |
ARC Antibody |
1-CSB-PA698018 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ARC. Recognizes ARC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
Anti-p16 ARC Rabbit Monoclonal Antibody |
M02096 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal p16 ARC Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
Polyclonal NOL3 / ARC Antibody (aa159-208) |
AMM06743G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL3 / ARC (aa159-208). This antibody is tested and proven to work in the following applications: |
ARC Conjugated Antibody |
C33325 |
SAB |
100ul |
EUR 397 |
ARC / ARG3.1 Antibody |
abx230524-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
p16 ARC Antibody |
48673-100ul |
SAB |
100ul |
EUR 333 |
p16 ARC Antibody |
48673-50ul |
SAB |
50ul |
EUR 239 |
p21-ARC antibody |
22102-100ul |
SAB |
100ul |
EUR 390 |
p21 ARC antibody |
70R-12631 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal p21 ARC antibody |
Anti-Arc Antibody |
PB9753 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-Arc Antibody |
PA1390 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-ARC antibody |
STJ192386 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ARC |
Polyclonal ARPC2 / p34-Arc Antibody (C-Terminus) |
APR15062G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARPC2 / p34-Arc (C-Terminus). This antibody is tested and proven to work in the following applications: |
ARC siRNA |
20-abx900398 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARC siRNA |
20-abx907915 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ARC siRNA |
20-abx907916 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ARC |
YF-PA27515 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ARC |
p16 ARC Conjugated Antibody |
C48673 |
SAB |
100ul |
EUR 397 |
anti- ARC/ARG3.1 antibody |
FNab00524 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: activity-regulated cytoskeleton-associated protein
- Uniprot ID: Q7LC44
- Gene ID: 23237
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against ARC/ARG3.1 |
Human p16 ARC Antibody |
32957-05111 |
AssayPro |
150 ug |
EUR 261 |
Human p21-ARC Antibody |
33339-05111 |
AssayPro |
150 ug |
EUR 261 |
Polyclonal ARPC1B / p41-ARC / ARP2 Antibody (N-Terminus) |
APR15059G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ARPC1B / p41-ARC / ARP2 (N-Terminus). This antibody is tested and proven to work in the following applications: |
ARC 239 dihydrochloride |
B6508-25 |
ApexBio |
25 mg |
EUR 535 |
Description: ARC 239 dihydrochloride is a selective antagonist of ?2B adrenoceptor with pKD value of 8.8 [1]. ?2B adrenoceptor is a G-protein coupled receptor. |
ARC 239 dihydrochloride |
B6508-5 |
ApexBio |
5 mg |
EUR 177 |
Description: ARC 239 dihydrochloride is a selective antagonist of ?2B adrenoceptor with pKD value of 8.8 [1]. ?2B adrenoceptor is a G-protein coupled receptor. |
ARC Blocking Peptide |
AF0118-BP |
Affbiotech |
1mg |
EUR 195 |
ARC Blocking Peptide |
33R-2533 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARC antibody, catalog no. 70R-8315 |
ARC Blocking Peptide |
33R-2534 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARC antibody, catalog no. 70R-4422 |
ARC cloning plasmid |
CSB-CL001981HU-10ug |
Cusabio |
10ug |
EUR 443 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1191
- Sequence: atggagctggaccaccggaccagcggcgggctccacgcctaccccgggccgcggggcgggcaggtggccaagcccaacgtgatcctgcagatcgggaagtgccgggccgagatgctggagcacgtgcggcggacgcaccggcacctgctggccgaggtgtccaagcaggtggagc
- Show more
|
Description: A cloning plasmid for the ARC gene. |
anti-p16 ARC |
YF-PA25480 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to p16 ARC |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human) |
4-PAJ620Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC) |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human), APC |
4-PAJ620Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC). This antibody is labeled with APC. |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human), Biotinylated |
4-PAJ620Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC). This antibody is labeled with Biotin. |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human), Cy3 |
4-PAJ620Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC). This antibody is labeled with Cy3. |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human), FITC |
4-PAJ620Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC). This antibody is labeled with FITC. |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human), HRP |
4-PAJ620Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC). This antibody is labeled with HRP. |
Activity Regulated Cytoskeleton Associated Protein (ARC) Polyclonal Antibody (Human), PE |
4-PAJ620Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ARC linked with RRNSSSVD(Cys96~Gln356+(RRNSSSVDKLAAALEHHHHHH))
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Activity Regulated Cytoskeleton Associated Protein (ARC). This antibody is labeled with PE. |
Human p16 ARC Antibody (Biotin Conjugate) |
32957-05121 |
AssayPro |
150 ug |
EUR 369 |
Human p21-ARC Antibody (Biotin Conjugate) |
33339-05121 |
AssayPro |
150 ug |
EUR 369 |
ARC Cell ELISA Kit |
abx595636-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Rat ARC shRNA Plasmid |
20-abx985843 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ARC shRNA Plasmid |
20-abx958112 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ARC protein (His tag) |
80R-2720 |
Fitzgerald |
10 ug |
EUR 322 |
Description: Purified recombinant ARC protein (His tag) |
ARC Rabbit Polyclonal Antibody