BAMBI Rabbit Polyclonal Antibody
 BAMBI Polyclonal Antibody |
|
ABP57886-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BAMBI protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BAMBI from Human, Mouse, Rat. This BAMBI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAMBI protein |
BAMBI Polyclonal Antibody |
|
ABP57886-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BAMBI protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BAMBI from Human, Mouse, Rat. This BAMBI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAMBI protein |
BAMBI Polyclonal Antibody |
|
ABP57886-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BAMBI protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of BAMBI from Human, Mouse, Rat. This BAMBI antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BAMBI protein |
 BAMBI Rabbit pAb |
|
A13589-100ul |
Abclonal |
100 ul |
EUR 308 |
BAMBI Rabbit pAb |
|
A13589-200ul |
Abclonal |
200 ul |
EUR 459 |
BAMBI Rabbit pAb |
|
A13589-20ul |
Abclonal |
20 ul |
EUR 183 |
BAMBI Rabbit pAb |
|
A13589-50ul |
Abclonal |
50 ul |
EUR 223 |
BAMBI Rabbit pAb |
|
A6532-100ul |
Abclonal |
100 ul |
EUR 308 |
BAMBI Rabbit pAb |
|
A6532-200ul |
Abclonal |
200 ul |
EUR 459 |
BAMBI Rabbit pAb |
|
A6532-20ul |
Abclonal |
20 ul |
EUR 183 |
BAMBI Rabbit pAb |
|
A6532-50ul |
Abclonal |
50 ul |
EUR 223 |
) Polyclonal BAMBI Antibody (Internal) |
|
APR15106G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAMBI (Internal). This antibody is tested and proven to work in the following applications: |
 BAMBI antibody |
|
38985-100ul |
SAB |
100ul |
EUR 252 |
BAMBI antibody |
|
70R-15960 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal BAMBI antibody |
 BAMBI Antibody |
|
DF12355 |
Affbiotech |
200ul |
EUR 304 |
|
Description: BAMBI antibody detects endogenous levels of BAMBI. |
BAMBI Antibody |
|
1-CSB-PA002549GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against BAMBI. Recognizes BAMBI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
BAMBI Antibody |
|
1-CSB-PA615666ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
|
|
Description: A polyclonal antibody against BAMBI. Recognizes BAMBI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 ELISA Kit) Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit |
|
DLR-BAMBI-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit |
|
DLR-BAMBI-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit |
|
RD-BAMBI-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit |
|
RD-BAMBI-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit |
|
RDR-BAMBI-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) ELISA Kit |
|
RDR-BAMBI-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
 BAMBI Conjugated Antibody |
|
C38985 |
SAB |
100ul |
EUR 397 |
 anti- BAMBI antibody |
|
FNab00797 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:1000
- IP: 1:200-1:1000
- Immunogen: BMP and activin membrane-bound inhibitor homolog(Xenopus laevis)
- Uniprot ID: Q13145
- Gene ID: 25805
- Research Area: Cancer
|
|
Description: Antibody raised against BAMBI |
 Anti-BAMBI antibody |
|
STJ28615 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a transmembrane glycoprotein related to the type I receptors of the transforming growth factor-beta (TGF-beta) family, whose members play important roles in signal transduction in many developmental and pathological processes. The encoded protein however is a pseudoreceptor, lacking an intracellular serine/threonine kinase domain required for signaling. Similar proteins in frog, mouse and zebrafish function as negative regulators of TGF-beta, which has led to the suggestion that the encoded protein may function to limit the signaling range of the TGF-beta family during early embryogenesis. |
Anti-BAMBI antibody |
|
STJ115550 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a transmembrane glycoprotein related to the type I receptors of the transforming growth factor-beta (TGF-beta) family, whose members play important roles in signal transduction in many developmental and pathological processes. The encoded protein however is a pseudoreceptor, lacking an intracellular serine/threonine kinase domain required for signaling. Similar proteins in frog, mouse and zebrafish function as negative regulators of TGF-beta, which has led to the suggestion that the encoded protein may function to limit the signaling range of the TGF-beta family during early embryogenesis. |
Anti-BAMBI antibody |
|
STJ192114 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to BAMBI |
 BAMBI siRNA |
|
20-abx900590 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAMBI siRNA |
|
20-abx908869 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAMBI siRNA |
|
20-abx908870 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Anti-BAMBI/NMA Antibody |
|
A07983-1 |
BosterBio |
100ug/vial |
EUR 294 |
 BAMBI cloning plasmid |
|
CSB-CL615666HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 783
- Sequence: atggatcgccactccagctacatcttcatctggctgcagctggagctctgcgccatggccgtgctgctcaccaaaggtgaaattcgatgctactgtgatgctgcccactgtgtagccactggttatatgtgtaaatctgagctcagcgcctgcttctctagacttcttgatcctca
- Show more
|
|
Description: A cloning plasmid for the BAMBI gene. |
 BAMBI Blocking Peptide |
|
20-abx161027 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAMBI Blocking Peptide |
|
DF12355-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse BAMBI shRNA Plasmid |
|
20-abx976442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat BAMBI shRNA Plasmid |
|
20-abx986879 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human BAMBI shRNA Plasmid |
|
20-abx958509 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) BAMBI Recombinant Protein (Human) |
|
RP002611 |
ABM |
100 ug |
Ask for price |
) BAMBI Recombinant Protein (Rat) |
|
RP191858 |
ABM |
100 ug |
Ask for price |
) BAMBI Recombinant Protein (Mouse) |
|
RP118706 |
ABM |
100 ug |
Ask for price |
) Anti-BAMBI (3C1-1D1) |
|
YF-MA20180 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to BAMBI |
 Polyclonal Antibody (Human)) BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) Polyclonal Antibody (Human) |
|
4-PAJ566Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: BAMBI (Arg29~Asp130)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human BMP And Activin Membrane Bound Inhibitor Homolog (BAMBI) |
BAMBI Rabbit Polyclonal Antibody
