C1D Rabbit Polyclonal Antibody

C1D Rabbit Polyclonal Antibody

C1D Polyclonal Antibody
ES11140-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against C1D from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

C1D Rabbit pAb
A6448-100ul 100 ul
EUR 308

C1D Rabbit pAb
A6448-200ul 200 ul
EUR 459

C1D Rabbit pAb
A6448-20ul 20 ul
EUR 183

C1D Rabbit pAb
A6448-50ul 50 ul
EUR 223

C1D antibody
70R-16071 50 ul
EUR 435
Description: Rabbit polyclonal C1D antibody

C1D antibody
70R-15387 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody

C1D antibody
38926-100ul 100ul
EUR 252

C1D Antibody
1-CSB-PA003488GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

C1D Antibody
1-CSB-PA03474A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:500-1:1000

C1D antibody
70R-8923 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal C1D antibody

C1D antibody
70R-8924 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal C1D antibody

Polyclonal C1D Antibody (aa1-135)
APR03350G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human C1D (aa1-135). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-C1D Antibody
APG00052G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-C1D . This antibody is tested and proven to work in the following applications:

C1D Polyclonal Antibody, HRP Conjugated
A56636 100 µg
EUR 570.55
Description: The best epigenetics products

C1D Polyclonal Antibody, FITC Conjugated
A56637 100 µg
EUR 570.55
Description: kits suitable for this type of research

C1D Polyclonal Antibody, Biotin Conjugated
A56638 100 µg
EUR 570.55
Description: fast delivery possible

C1D
PR27269 2 ug
EUR 191

C1D antibody (HRP)
60R-1981 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody (HRP)

C1D antibody (FITC)
60R-1982 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody (FITC)

C1D antibody (biotin)
60R-1983 100 ug
EUR 327
Description: Rabbit polyclonal C1D antibody (biotin)

C1D Conjugated Antibody
C38926 100ul
EUR 397

anti- C1D antibody
FNab01056 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: C1D nuclear receptor co-repressor
  • Uniprot ID: Q13901
  • Gene ID: 10438
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against C1D

Anti-C1D antibody
PAab01056 100 ug
EUR 386

Anti-C1D antibody
STJ28531 100 µl
EUR 277
Description: The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10.

Anti-C1D antibody
STJ71783 100 µg
EUR 359

Anti-C1D antibody
STJ192298 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to C1D

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody
20-abx004941
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody
20-abx111283
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody
20-abx109339
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody
abx432429-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody
abx231056-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

C1D siRNA
20-abx909636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

C1D siRNA
20-abx909637
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-C1D
YF-PA25576 50 ul
EUR 334
Description: Mouse polyclonal to C1D

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody (Biotin)
20-abx105727
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody (FITC)
20-abx107145
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Antibody (HRP)
20-abx108566
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

C1D Antibody, HRP conjugated
1-CSB-PA03474B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

C1D Antibody, FITC conjugated
1-CSB-PA03474C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

C1D Antibody, Biotin conjugated
1-CSB-PA03474D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against C1D. Recognizes C1D from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Nuclear nucleic acid-binding protein C1D (C1D)
1-CSB-RP034744h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Nuclear nucleic acid-binding protein C1D(C1D),partial expressed in E.coli

Nuclear Nucleic Acid-Binding Protein C1D (C1D) Protein
20-abx262625
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

C1D Blocking Peptide
33R-4854 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of C1D antibody, catalog no. 70R-8924

C1D Blocking Peptide
33R-1192 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL6 antibody, catalog no. 70R-1441

C1D cloning plasmid
CSB-CL623834HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttc
  • Show more
Description: A cloning plasmid for the C1D gene.

C1D cloning plasmid
CSB-CL623834HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttc
  • Show more
Description: A cloning plasmid for the C1D gene.

pCMV-SPORT6-C1D
PVT13189 2 ug
EUR 391

Anti-C1D (6H2)
YF-MA11287 50 ug
EUR 363
Description: Mouse monoclonal to C1D

Anti-C1D (6H2)
YF-MA17303 200 ul
EUR 363
Description: Mouse monoclonal to C1D

Anti-C1D (4H5)
YF-MA17304 100 ug
EUR 363
Description: Mouse monoclonal to C1D

Chicken Nuclear nucleic acid- binding protein C1D, C1D ELISA KIT
ELI-25339c 96 Tests
EUR 928

C1D ELISA Kit| Bovine Nuclear nucleic acid-binding protein C1D
EF011178 96 Tests
EUR 689

C1D ELISA Kit| chicken Nuclear nucleic acid-binding protein C1D
EF012227 96 Tests
EUR 689

Human Nuclear Nucleic Acid-Binding Protein C1D (C1D) ELISA Kit
20-abx386167
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Nuclear Nucleic Acid-Binding Protein C1D (C1D) ELISA Kit
abx388728-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Nuclear nucleic acid- binding protein C1D, C1D ELISA KIT
ELI-33295h 96 Tests
EUR 824

Mouse Nuclear nucleic acid- binding protein C1D, C1d ELISA KIT
ELI-34629m 96 Tests
EUR 865

Bovine Nuclear nucleic acid- binding protein C1D, C1D ELISA KIT
ELI-49309b 96 Tests
EUR 928

C1D protein (His tag)
80R-2852 50 ug
EUR 424
Description: Purified recombinant C1D protein (His tag)

C1D ELISA KIT|Human
EF008241 96 Tests
EUR 689

Mouse C1D shRNA Plasmid
20-abx974974
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human C1D shRNA Plasmid
20-abx957080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

C1D Human Recombinant Protein
PROTQ13901 Regular: 10ug
EUR 317
Description: C1D Human Recombinant produced in E. coli is a single polypeptide chain containing 164 amino acids (1-141) and having a molecular mass of 18.4kDa. C1D is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

C1D Recombinant Protein (Human)
RP004138 100 ug Ask for price

C1D Recombinant Protein (Human)
RP004141 100 ug Ask for price

C1D Recombinant Protein (Rat)
RP192608 100 ug Ask for price

C1D Recombinant Protein (Mouse)
RP120227 100 ug Ask for price

C1d ELISA Kit| Mouse Nuclear nucleic acid-binding protein C1D E
EF014353 96 Tests
EUR 689

Monoclonal C1D Antibody (monoclonal) (M03), Clone: 6H2
AMM03300G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human C1D (monoclonal) (M03). The antibodies are raised in mouse and are from clone 6H2. This antibody is applicable in WB, IHC and IF, E

C1d ORF Vector (Rat) (pORF)
ORF064204 1.0 ug DNA
EUR 506

C1D ORF Vector (Human) (pORF)
ORF001380 1.0 ug DNA
EUR 95

C1D ORF Vector (Human) (pORF)
ORF001381 1.0 ug DNA
EUR 95

C1d ORF Vector (Mouse) (pORF)
ORF040077 1.0 ug DNA
EUR 506

C1d sgRNA CRISPR Lentivector set (Mouse)
K4887601 3 x 1.0 ug
EUR 339

C1d sgRNA CRISPR Lentivector set (Rat)
K7295601 3 x 1.0 ug
EUR 339

C1D sgRNA CRISPR Lentivector set (Human)
K0204401 3 x 1.0 ug
EUR 339

C1d sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4887602 1.0 ug DNA
EUR 154

C1d sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4887603 1.0 ug DNA
EUR 154

C1d sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4887604 1.0 ug DNA
EUR 154

C1d sgRNA CRISPR Lentivector (Rat) (Target 1)
K7295602 1.0 ug DNA
EUR 154

C1d sgRNA CRISPR Lentivector (Rat) (Target 2)
K7295603 1.0 ug DNA
EUR 154

C1d sgRNA CRISPR Lentivector (Rat) (Target 3)
K7295604 1.0 ug DNA
EUR 154

C1D sgRNA CRISPR Lentivector (Human) (Target 1)
K0204402 1.0 ug DNA
EUR 154

C1D sgRNA CRISPR Lentivector (Human) (Target 2)
K0204403 1.0 ug DNA
EUR 154

C1D sgRNA CRISPR Lentivector (Human) (Target 3)
K0204404 1.0 ug DNA
EUR 154

C1D Protein Vector (Mouse) (pPB-C-His)
PV160306 500 ng
EUR 603

C1D Protein Vector (Mouse) (pPB-N-His)
PV160307 500 ng
EUR 603

C1D Protein Vector (Mouse) (pPM-C-HA)
PV160308 500 ng
EUR 603

C1D Protein Vector (Mouse) (pPM-C-His)
PV160309 500 ng
EUR 603

C1D Protein Vector (Rat) (pPB-C-His)
PV256814 500 ng
EUR 603

C1D Protein Vector (Rat) (pPB-N-His)
PV256815 500 ng
EUR 603

C1D Protein Vector (Rat) (pPM-C-HA)
PV256816 500 ng
EUR 603

C1D Protein Vector (Rat) (pPM-C-His)
PV256817 500 ng
EUR 603

C1D Protein Vector (Human) (pPB-His-MBP)
PV329730 500 ng
EUR 329

C1D Rabbit Polyclonal Antibody