셀타젠 Genetic Genotyping

CALCA Rabbit Polyclonal Antibody

CALCA Polyclonal Antibody

ABP57963-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody

ABP57963-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120
  • Applications tips:
Description: A polyclonal antibody for detection of CALCA from Human, Mouse, Rat. This CALCA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CALCA protein at amino acid sequence of 71-120

CALCA Polyclonal Antibody

ES11390-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CALCA Polyclonal Antibody

ES11390-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CALCA from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA


  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CALCA/CALCA. Recognizes CALCA/CALCA from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

CALCA / CALCA Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CALCA Rabbit pAb

A13957-100ul 100 ul
EUR 308

CALCA Rabbit pAb

A13957-200ul 200 ul
EUR 459

CALCA Rabbit pAb

A13957-20ul 20 ul
EUR 183

CALCA Rabbit pAb

A13957-50ul 50 ul
EUR 223

CALCA Rabbit pAb

A11804-100ul 100 ul
EUR 308

CALCA Rabbit pAb

A11804-200ul 200 ul
EUR 459

CALCA Rabbit pAb

A11804-20ul 20 ul Ask for price

CALCA Rabbit pAb

A11804-50ul 50 ul Ask for price

Polyclonal CALCA Antibody (Center)

APR11539G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA (Center). This antibody is tested and proven to work in the following applications:

CALCA/CALCB Polyclonal Conjugated Antibody

C31944 100ul
EUR 397

CALCA Polyclonal Antibody, Biotin Conjugated

A52254 100 µg
EUR 570.55
Description: kits suitable for this type of research

CALCA Polyclonal Antibody, FITC Conjugated

A52255 100 µg
EUR 570.55
Description: fast delivery possible

CALCA Polyclonal Antibody, HRP Conjugated

A52256 100 µg
EUR 570.55
Description: reagents widely cited

CALCA Antibody

32898-100ul 100ul
EUR 252

CALCA antibody

10R-8356 100 ul
EUR 392
Description: Mouse monoclonal CALCA antibody

CALCA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CALCA Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

CALCA Antibody

DF7386 200ul
EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.

CALCA Antibody

DF7785 200ul
EUR 304
Description: CALCA Antibody detects endogenous levels of total CALCA.

CALCA Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CALCA Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

CALCA Antibody

ABD7386 100 ug
EUR 438

CALCA Antibody

ABD7785 100 ug
EUR 438

CALCA Antibody

ABD7786 100 ug
EUR 438

CALCA Antibody

ABD7985 100 ug
EUR 438

Polyclonal CALCA/CT Antibody (C-term)

APR04041G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCA/CT (C-term). This antibody is tested and proven to work in the following applications:

Rabbit Calcitonin (CALCA) ELISA Kit

abx256998-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

CALCA/CALCB antibody

31944-100ul 100ul
EUR 252

CALCA/CALCB antibody

31944-50ul 50ul
EUR 187

Calcitonin (CALCA) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx022516-20ul 20 ul
EUR 328
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx025389-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx025390-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx025390-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx026097-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx026097-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calcitonin (CALCA) Antibody

  • EUR 342.00
  • EUR 899.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody

  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcitonin (CALCA) Antibody

abx146688-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx148151-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx028427-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcitonin (CALCA) Antibody

abx028427-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CALCA Conjugated Antibody

C32898 100ul
EUR 397

Anti-CALCA antibody

STJ27531 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA antibody

STJ113383 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA antibody

STJ115892 100 µl
EUR 277
Description: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator and as an antimicrobial peptide while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CALCA Antibody

STJ500585 100 µg
EUR 476

Anti-CALCA Antibody

STJ500586 100 µg
EUR 476

Anti-CALCA antibody

STJ192548 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CALCA

Calca/ Rat Calca ELISA Kit

ELI-25243r 96 Tests
EUR 886

CALCA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is HRP conjugated. Tested in the following application: ELISA

CALCA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is FITC conjugated. Tested in the following application: ELISA

CALCA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Dog. This antibody is Biotin conjugated. Tested in the following application: ELISA

CALCA Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CALCA Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CALCA Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CALCA. Recognizes CALCA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Calcitonin/Calca Antibody

A02352 100ug/vial
EUR 334

Anti-Calcitonin/CALCA Antibody

PB9936 100ug/vial
EUR 334

Anti-Calcitonin/CALCA Antibody

PB9937 100ug/vial
EUR 334

Anti-CALCA Antibody (Biotin)

STJ500587 100 µg
EUR 586

Anti-CALCA Antibody (FITC)

STJ500588 100 µg
EUR 586

Anti-CALCA Antibody (Biotin)

STJ500589 100 µg
EUR 586

Anti-CALCA Antibody (FITC)

STJ500590 100 µg
EUR 586

Dog Calcitonin (CALCA)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Dog Calcitonin(CALCA),partial expressed in E.coli

CALCA Blocking Peptide

DF7386-BP 1mg
EUR 195

CALCA Blocking Peptide

DF7785-BP 1mg
EUR 195

CALCA cloning plasmid

CSB-CL004434HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 426
  • Sequence: atgggcttccaaaagttctcccccttcctggctctcagcatcttggtcctgttgcaggcaggcagcctccatgcagcaccattcaggtctgccctggagagcagcccagcagacccggccacgctcagtgaggacgaagcgcgcctcctgctggctgcactggtgcaggactatgt
  • Show more
Description: A cloning plasmid for the CALCA gene.

Monoclonal CALCA/CT Antibody, Clone: 406CT21.4.3

AMM02399G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human CALCA/CT. The antibodies are raised in Mouse and are from clone 406CT21.4.3. This antibody is applicable in WB, E


ELA-E1213h 96 Tests
EUR 824


EF004510 96 Tests
EUR 689

Rat CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Katacalcin (CALCA) Protein

abx670053-01mg 0.1 mg
EUR 286
  • Shipped within 1 week.

Mouse CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CALCA shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-50378d 96 Tests
EUR 928

CALCA Recombinant Protein (Human)

RP005446 100 ug Ask for price

CALCA Recombinant Protein (Rat)

RP192887 100 ug Ask for price

CALCA Recombinant Protein (Rat)

RP192890 100 ug Ask for price

CALCA Recombinant Protein (Rat)

RP192893 100 ug Ask for price

CALCA Recombinant Protein (Mouse)

RP120794 100 ug Ask for price

CALCA Recombinant Protein (Mouse)

RP120797 100 ug Ask for price


STJ150014 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in Mouse serum, plasma and other biological fluids


STJ150046 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in Rat serum, plasma and other biological fluids


STJ150115 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CT in human serum, plasma and other biological fluids


STJ150272 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CGRP in Mouse serum, plasma and other biological fluids


STJ150492 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of CGRP in Rat serum, plasma and other biological fluids

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal CALCA Antibody (monoclonal) (M01), Clone: 4B10

APR11540G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CALCA (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4B10. This antibody is applicable in WB, E

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

abx411020-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

abx411021-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcitonin Gene-Related Peptide 1 (CALCA) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal CALCA/CT Antibody(Ascites), Clone: 406CT21.4.3

AMM02398G 0.1 ml
EUR 484
Description: A Monoclonal antibody against Human CALCA/CT(Ascites). The antibodies are raised in Mouse and are from clone 406CT21.4.3. This antibody is applicable in WB, E

Mouse Calcitonin (CALCA) ELISA Kit

  • EUR 6971.00
  • EUR 3714.00
  • EUR 864.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Calcitonin (CALCA) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Calcitonin (CALCA) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Calcitonin (CALCA) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Calcitonin (CALCA) ELISA Kit

  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Calcitonin (CALCA) ELISA Kit

abx255294-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Calcitonin (CALCA) ELISA Kit

abx256835-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Calcitonin (CALCA) ELISA Kit

abx250659-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Calcitonin (CALCA) ELISA Kit

abx253160-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Calcitonin, Calca ELISA KIT

ELI-11082r 96 Tests
EUR 886

Canine Calcitonin, CALCA ELISA KIT

ELI-11765d 96 Tests
EUR 928

Mouse Calcitonin, Calca ELISA KIT

ELI-25043m 96 Tests
EUR 865

CALCA Rabbit Polyclonal Antibody