CALCR Rabbit Polyclonal Antibody
 CALCR antibody |
|
70R-9835 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal CALCR antibody |
 CALCR Antibody |
|
35633-100ul |
SAB |
100ul |
EUR 252 |
CALCR Antibody |
|
DF10202 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CALCR Antibody detects endogenous levels of total CALCR. |
CALCR Antibody |
|
1-CSB-PA004439ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CALCR Antibody |
|
1-CSB-PA292099 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
CALCR Antibody |
|
1-CSB-PA153268 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50 |
) Polyclonal CALCR Antibody (C-term) |
|
APR05669G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR (C-term). This antibody is tested and proven to work in the following applications: |
 polyclonal antibody) Calcitonin receptor (CALCR) polyclonal antibody |
|
ABP-PAB-10551 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cell Surface Molecules / GPCRs
- Brand:
|
 CALCR Conjugated Antibody |
|
C35633 |
SAB |
100ul |
EUR 397 |
 Anti-CALCR antibody |
|
STJ192613 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CALCR |
 CALCR siRNA |
|
20-abx900749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALCR siRNA |
|
20-abx910147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALCR siRNA |
|
20-abx910148 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Polyclonal CALCR / Calcitonin Receptor Antibody (N-Terminus) |
|
APR01934G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (N-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal CALCR / Calcitonin Receptor Antibody (Transmembrane Domain) |
|
APR01935G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (Transmembrane Domain). This antibody is tested and proven to work in the following applications: |
) Polyclonal CALCR / Calcitonin Receptor Antibody (C-Terminus) |
|
APR01936G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (C-Terminus). This antibody is tested and proven to work in the following applications: |
 ELISA Kit) Rabbit Calcitonin Receptor (CALCR) ELISA Kit |
|
abx363615-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Rabbit Calcitonin receptor, CALCR ELISA KIT |
|
ELI-10824Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 Antibody) Calcitonin Receptor (CALCR) Antibody |
|
abx032587-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
abx032587-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
20-abx322776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
20-abx339721 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
abx412504-01mg |
Abbexa |
0.1 mg |
EUR 704 |
|
|
Calcitonin Receptor (CALCR) Antibody |
|
abx412505-10ug |
Abbexa |
10 ug |
EUR 370 |
|
|
Calcitonin Receptor (CALCR) Antibody |
|
abx413817-01mg |
Abbexa |
0.1 mg |
EUR 746 |
|
|
Calcitonin Receptor (CALCR) Antibody |
|
20-abx210505 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CALCR cloning plasmid |
|
CSB-CL004439HU-10ug |
Cusabio |
10ug |
EUR 509 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1425
- Sequence: atgaggttcacatttacaagccggtgcttggcactgtttcttcttctaaatcacccaaccccaattcttcctgccttttcaaatcaaacctatccaacaatagagcccaagccatttctttacgtcgtaggacgaaagaagatgatggatgcacagtacaaatgctatgaccgaa
- Show more
|
|
Description: A cloning plasmid for the CALCR gene. |
 CALCR Blocking Peptide |
|
33R-6844 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CALCR antibody, catalog no. 70R-9835 |
CALCR Blocking Peptide |
|
DF10202-BP |
Affbiotech |
1mg |
EUR 195 |
 Rat CALCR shRNA Plasmid |
|
20-abx987263 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CALCR shRNA Plasmid |
|
20-abx950560 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse CALCR shRNA Plasmid |
|
20-abx969442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CALCR Recombinant Protein (Human) |
|
RP005461 |
ABM |
100 ug |
Ask for price |
) CALCR Recombinant Protein (Rat) |
|
RP192902 |
ABM |
100 ug |
Ask for price |
CALCR Recombinant Protein (Rat) |
|
RP192905 |
ABM |
100 ug |
Ask for price |
) CALCR Recombinant Protein (Mouse) |
|
RP120812 |
ABM |
100 ug |
Ask for price |
CALCR Recombinant Protein (Mouse) |
|
RP120815 |
ABM |
100 ug |
Ask for price |
 (pORF)) CALCR ORF Vector (Human) (pORF) |
|
ORF001821 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Calcr ORF Vector (Mouse) (pORF) |
|
ORF040272 |
ABM |
1.0 ug DNA |
EUR 506 |
Calcr ORF Vector (Mouse) (pORF) |
|
ORF040273 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Calcr ORF Vector (Rat) (pORF) |
|
ORF064302 |
ABM |
1.0 ug DNA |
EUR 506 |
Calcr ORF Vector (Rat) (pORF) |
|
ORF064303 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA Kit) Pig Calcitonin Receptor (CALCR) ELISA Kit |
|
abx360605-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Sheep Calcitonin Receptor (CALCR) ELISA Kit |
|
abx364277-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
 Porcine Calcitonin receptor, CALCR ELISA KIT |
|
ELI-10823p |
Lifescience Market |
96 Tests |
EUR 928 |
) CALCR sgRNA CRISPR Lentivector set (Human) |
|
K0354801 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA Kit) Human Calcitonin Receptor (CALCR) ELISA Kit |
|
abx351378-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Calcitonin Receptor (CALCR) ELISA Kit |
|
abx352533-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Calcitonin Receptor (CALCR) ELISA Kit |
|
abx358875-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Calcitonin Receptor (CALCR) ELISA Kit |
|
abx355652-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Calcitonin Receptor (CALCR) ELISA Kit |
|
abx391053-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) Calcr sgRNA CRISPR Lentivector set (Mouse) |
|
K4540901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Calcr sgRNA CRISPR Lentivector set (Rat) |
|
K7000201 |
ABM |
3 x 1.0 ug |
EUR 339 |
, Clone: 2F7) Monoclonal CALCR / Calcitonin Receptor Antibody (clone 2F7), Clone: 2F7 |
|
AMM02230G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human CALCR / Calcitonin Receptor (clone 2F7). The antibodies are raised in Mouse and are from clone 2F7. This antibody is applicable in WB and IHC-P, E |
 (Target 1)) CALCR sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0354802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CALCR sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0354803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CALCR sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0354804 |
ABM |
1.0 ug DNA |
EUR 154 |
 ELISA Kit) Guinea pig Calcitonin Receptor (CALCR) ELISA Kit |
|
abx357668-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 (Target 1)) Calcr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4540902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Calcr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4540903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Calcr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4540904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Calcr sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7000202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Calcr sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7000203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Calcr sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7000204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CALCR Protein Vector (Human) (pPB-C-His) |
|
PV007281 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CALCR Protein Vector (Human) (pPB-N-His) |
|
PV007282 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CALCR Protein Vector (Human) (pPM-C-HA) |
|
PV007283 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CALCR Protein Vector (Human) (pPM-C-His) |
|
PV007284 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) CALCR Protein Vector (Rat) (pPB-C-His) |
|
PV257206 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CALCR Protein Vector (Rat) (pPB-N-His) |
|
PV257207 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CALCR Protein Vector (Rat) (pPM-C-HA) |
|
PV257208 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CALCR Protein Vector (Rat) (pPM-C-His) |
|
PV257209 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPB-C-His) |
|
PV257210 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPB-N-His) |
|
PV257211 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPM-C-HA) |
|
PV257212 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPM-C-His) |
|
PV257213 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CALCR Protein Vector (Mouse) (pPB-C-His) |
|
PV161086 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CALCR Protein Vector (Mouse) (pPB-N-His) |
|
PV161087 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CALCR Protein Vector (Mouse) (pPM-C-HA) |
|
PV161088 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CALCR Protein Vector (Mouse) (pPM-C-His) |
|
PV161089 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPB-C-His) |
|
PV161090 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPB-N-His) |
|
PV161091 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPM-C-HA) |
|
PV161092 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPM-C-His) |
|
PV161093 |
ABM |
500 ng |
EUR 603 |
 Calcr 3'UTR Luciferase Stable Cell Line |
|
TU201583 |
ABM |
1.0 ml |
Ask for price |
 Calcr 3'UTR GFP Stable Cell Line |
|
TU153051 |
ABM |
1.0 ml |
Ask for price |
 CALCR 3'UTR Luciferase Stable Cell Line |
|
TU003396 |
ABM |
1.0 ml |
EUR 1521 |
Calcr 3'UTR Luciferase Stable Cell Line |
|
TU103051 |
ABM |
1.0 ml |
Ask for price |
 CALCR 3'UTR GFP Stable Cell Line |
|
TU053396 |
ABM |
1.0 ml |
EUR 1521 |
Calcr 3'UTR GFP Stable Cell Line |
|
TU251583 |
ABM |
1.0 ml |
Ask for price |
 Calcr ELISA Kit| Rat Calcitonin receptor ELISA Kit |
|
EF018406 |
Lifescience Market |
96 Tests |
EUR 689 |
 Calcr ELISA Kit| Mouse Calcitonin receptor ELISA Kit |
|
EF014360 |
Lifescience Market |
96 Tests |
EUR 689 |
 (CMV) (pLenti-GIII-CMV)) CALCR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV680797 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) CALCR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV680801 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) CALCR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV680802 |
ABM |
1.0 ug DNA |
EUR 682 |
CALCR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV680821 |
ABM |
1.0 ug DNA |
EUR 682 |
CALCR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV680825 |
ABM |
1.0 ug DNA |
EUR 682 |
CALCR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV680826 |
ABM |
1.0 ug DNA |
EUR 682 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
CALCR Rabbit Polyclonal Antibody
