CALCR Rabbit Polyclonal Antibody
 CALCR Antibody |
|
35633-100ul |
SAB |
100ul |
EUR 252 |
CALCR Antibody |
|
1-CSB-PA004439ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CALCR Antibody |
|
DF10202 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CALCR Antibody detects endogenous levels of total CALCR. |
CALCR Antibody |
|
1-CSB-PA292099 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
CALCR Antibody |
|
1-CSB-PA153268 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50 |
 CALCR antibody |
|
70R-9835 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal CALCR antibody |
) Polyclonal CALCR Antibody (C-term) |
|
APR05669G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR (C-term). This antibody is tested and proven to work in the following applications: |
 polyclonal antibody) Calcitonin receptor (CALCR) polyclonal antibody |
|
ABP-PAB-10551 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cell Surface Molecules / GPCRs
- Brand:
|
 CALCR Conjugated Antibody |
|
C35633 |
SAB |
100ul |
EUR 397 |
 Anti-CALCR antibody |
|
STJ192613 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CALCR |
 CALCR siRNA |
|
20-abx900749 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALCR siRNA |
|
20-abx910147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CALCR siRNA |
|
20-abx910148 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Polyclonal CALCR / Calcitonin Receptor Antibody (N-Terminus) |
|
APR01934G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (N-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal CALCR / Calcitonin Receptor Antibody (Transmembrane Domain) |
|
APR01935G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (Transmembrane Domain). This antibody is tested and proven to work in the following applications: |
) Polyclonal CALCR / Calcitonin Receptor Antibody (C-Terminus) |
|
APR01936G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (C-Terminus). This antibody is tested and proven to work in the following applications: |
 Rabbit Calcitonin receptor, CALCR ELISA KIT |
|
ELI-10824Ra |
Lifescience Market |
96 Tests |
EUR 928 |
 ELISA Kit) Rabbit Calcitonin Receptor (CALCR) ELISA Kit |
|
abx363615-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Antibody) Calcitonin Receptor (CALCR) Antibody |
|
20-abx210505 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
abx032587-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
abx032587-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
abx412504-01mg |
Abbexa |
0.1 mg |
EUR 704 |
|
|
Calcitonin Receptor (CALCR) Antibody |
|
abx412505-10ug |
Abbexa |
10 ug |
EUR 370 |
|
|
Calcitonin Receptor (CALCR) Antibody |
|
abx413817-01mg |
Abbexa |
0.1 mg |
EUR 746 |
|
|
Calcitonin Receptor (CALCR) Antibody |
|
20-abx339721 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcitonin Receptor (CALCR) Antibody |
|
20-abx322776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CALCR Blocking Peptide |
|
33R-6844 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CALCR antibody, catalog no. 70R-9835 |
CALCR Blocking Peptide |
|
DF10202-BP |
Affbiotech |
1mg |
EUR 195 |
 CALCR cloning plasmid |
|
CSB-CL004439HU-10ug |
Cusabio |
10ug |
EUR 509 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1425
- Sequence: atgaggttcacatttacaagccggtgcttggcactgtttcttcttctaaatcacccaaccccaattcttcctgccttttcaaatcaaacctatccaacaatagagcccaagccatttctttacgtcgtaggacgaaagaagatgatggatgcacagtacaaatgctatgaccgaa
- Show more
|
|
Description: A cloning plasmid for the CALCR gene. |
 Rat CALCR shRNA Plasmid |
|
20-abx987263 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse CALCR shRNA Plasmid |
|
20-abx969442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CALCR shRNA Plasmid |
|
20-abx950560 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CALCR Recombinant Protein (Human) |
|
RP005461 |
ABM |
100 ug |
Ask for price |
) CALCR Recombinant Protein (Rat) |
|
RP192902 |
ABM |
100 ug |
Ask for price |
CALCR Recombinant Protein (Rat) |
|
RP192905 |
ABM |
100 ug |
Ask for price |
) CALCR Recombinant Protein (Mouse) |
|
RP120812 |
ABM |
100 ug |
Ask for price |
CALCR Recombinant Protein (Mouse) |
|
RP120815 |
ABM |
100 ug |
Ask for price |
 (pORF)) Calcr ORF Vector (Rat) (pORF) |
|
ORF064302 |
ABM |
1.0 ug DNA |
EUR 506 |
Calcr ORF Vector (Rat) (pORF) |
|
ORF064303 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CALCR ORF Vector (Human) (pORF) |
|
ORF001821 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Calcr ORF Vector (Mouse) (pORF) |
|
ORF040272 |
ABM |
1.0 ug DNA |
EUR 506 |
Calcr ORF Vector (Mouse) (pORF) |
|
ORF040273 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKEI00144)) CALCR ELISA Kit (Human) (OKEI00144) |
|
OKEI00144 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
|
Description: Description of target: This is a receptor for calcitonin. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. The calcitonin receptor is thought to couple to the heterotrimeric guanosine triphosphate-binding protein that is sensitive to cholera toxin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
 (OKEI00382)) CALCR ELISA Kit (Mouse) (OKEI00382) |
|
OKEI00382 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
|
Description: Description of target: This is a receptor for calcitonin. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. The calcitonin receptor is thought to couple to the heterotrimeric guanosine triphosphate-binding protein that is sensitive to cholera toxin. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
 Porcine Calcitonin receptor, CALCR ELISA KIT |
|
ELI-10823p |
Lifescience Market |
96 Tests |
EUR 928 |
 ELISA Kit) Pig Calcitonin Receptor (CALCR) ELISA Kit |
|
abx360605-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Calcitonin Receptor (CALCR) ELISA Kit |
|
abx391053-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Calcitonin Receptor (CALCR) ELISA Kit |
|
abx351378-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Calcitonin Receptor (CALCR) ELISA Kit |
|
abx352533-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Calcitonin Receptor (CALCR) ELISA Kit |
|
abx358875-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Calcitonin Receptor (CALCR) ELISA Kit |
|
abx355652-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Sheep Calcitonin Receptor (CALCR) ELISA Kit |
|
abx364277-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
) CALCR sgRNA CRISPR Lentivector set (Human) |
|
K0354801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Calcr sgRNA CRISPR Lentivector set (Rat) |
|
K7000201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Calcr sgRNA CRISPR Lentivector set (Mouse) |
|
K4540901 |
ABM |
3 x 1.0 ug |
EUR 339 |
, Clone: 2F7) Monoclonal CALCR / Calcitonin Receptor Antibody (clone 2F7), Clone: 2F7 |
|
AMM02230G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A Monoclonal antibody against Human CALCR / Calcitonin Receptor (clone 2F7). The antibodies are raised in Mouse and are from clone 2F7. This antibody is applicable in WB and IHC-P, E |
 ELISA Kit) Guinea pig Calcitonin Receptor (CALCR) ELISA Kit |
|
abx357668-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 (Target 1)) CALCR sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0354802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CALCR sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0354803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CALCR sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0354804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Calcr sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7000202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Calcr sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7000203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Calcr sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7000204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Calcr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4540902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Calcr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4540903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Calcr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4540904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CALCR Protein Vector (Mouse) (pPB-C-His) |
|
PV161086 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CALCR Protein Vector (Mouse) (pPB-N-His) |
|
PV161087 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CALCR Protein Vector (Mouse) (pPM-C-HA) |
|
PV161088 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CALCR Protein Vector (Mouse) (pPM-C-His) |
|
PV161089 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPB-C-His) |
|
PV161090 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPB-N-His) |
|
PV161091 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPM-C-HA) |
|
PV161092 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Mouse) (pPM-C-His) |
|
PV161093 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CALCR Protein Vector (Rat) (pPB-C-His) |
|
PV257206 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CALCR Protein Vector (Rat) (pPB-N-His) |
|
PV257207 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CALCR Protein Vector (Rat) (pPM-C-HA) |
|
PV257208 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CALCR Protein Vector (Rat) (pPM-C-His) |
|
PV257209 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPB-C-His) |
|
PV257210 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPB-N-His) |
|
PV257211 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPM-C-HA) |
|
PV257212 |
ABM |
500 ng |
EUR 603 |
CALCR Protein Vector (Rat) (pPM-C-His) |
|
PV257213 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CALCR Protein Vector (Human) (pPB-C-His) |
|
PV007281 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CALCR Protein Vector (Human) (pPB-N-His) |
|
PV007282 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CALCR Protein Vector (Human) (pPM-C-HA) |
|
PV007283 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CALCR Protein Vector (Human) (pPM-C-His) |
|
PV007284 |
ABM |
500 ng |
EUR 329 |
 Calcr 3'UTR GFP Stable Cell Line |
|
TU153051 |
ABM |
1.0 ml |
Ask for price |
 Calcr 3'UTR Luciferase Stable Cell Line |
|
TU103051 |
ABM |
1.0 ml |
Ask for price |
Calcr 3'UTR Luciferase Stable Cell Line |
|
TU201583 |
ABM |
1.0 ml |
Ask for price |
Calcr 3'UTR GFP Stable Cell Line |
|
TU251583 |
ABM |
1.0 ml |
Ask for price |
 CALCR 3'UTR GFP Stable Cell Line |
|
TU053396 |
ABM |
1.0 ml |
EUR 1521 |
 CALCR 3'UTR Luciferase Stable Cell Line |
|
TU003396 |
ABM |
1.0 ml |
EUR 1521 |
 Calcr ELISA Kit| Rat Calcitonin receptor ELISA Kit |
|
EF018406 |
Lifescience Market |
96 Tests |
EUR 689 |
 Calcr ELISA Kit| Mouse Calcitonin receptor ELISA Kit |
|
EF014360 |
Lifescience Market |
96 Tests |
EUR 689 |
 (CMV) (pLenti-GIII-CMV)) CALCR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV680797 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) CALCR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV680801 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) CALCR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV680802 |
ABM |
1.0 ug DNA |
EUR 682 |
CALCR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV680821 |
ABM |
1.0 ug DNA |
EUR 682 |
CALCR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV680825 |
ABM |
1.0 ug DNA |
EUR 682 |
CALCR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV680826 |
ABM |
1.0 ug DNA |
EUR 682 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
 JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
|
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
 JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
|
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
 MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
|
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
 MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
|
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
CALCR Rabbit Polyclonal Antibody
