CelltaGen
셀타젠 Genetic Genotyping

CALCR Rabbit Polyclonal Antibody

CALCR antibody

70R-9835 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CALCR antibody

CALCR Antibody

ABD10202 100 ug
EUR 438

CALCR Antibody

35633-100ul 100ul
EUR 252

CALCR Antibody

DF10202 200ul
EUR 304
Description: CALCR Antibody detects endogenous levels of total CALCR.

CALCR Antibody

1-CSB-PA004439ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CALCR Antibody

1-CSB-PA292099
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

CALCR Antibody

1-CSB-PA153268
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CALCR. Recognizes CALCR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:15-1:50

Polyclonal CALCR Antibody (C-term)

APR05669G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR (C-term). This antibody is tested and proven to work in the following applications:

Calcitonin receptor (CALCR) polyclonal antibody

ABP-PAB-10551 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:

Calcr/ Rat Calcr ELISA Kit

ELI-49265r 96 Tests
EUR 886

CALCR Conjugated Antibody

C35633 100ul
EUR 397

Anti-CALCR antibody

STJ192613 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CALCR

CALCR siRNA

20-abx900749
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALCR siRNA

20-abx910147
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CALCR siRNA

20-abx910148
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Polyclonal CALCR / Calcitonin Receptor Antibody (N-Terminus)

APR01934G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal CALCR / Calcitonin Receptor Antibody (Transmembrane Domain)

APR01935G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (Transmembrane Domain). This antibody is tested and proven to work in the following applications:

Polyclonal CALCR / Calcitonin Receptor Antibody (C-Terminus)

APR01936G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CALCR / Calcitonin Receptor (C-Terminus). This antibody is tested and proven to work in the following applications:

Rabbit Calcitonin Receptor (CALCR) ELISA Kit

abx363615-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Calcitonin receptor, CALCR ELISA KIT

ELI-10824Ra 96 Tests
EUR 928

Calcitonin Receptor (CALCR) Antibody

abx032587-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcitonin Receptor (CALCR) Antibody

abx032587-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Calcitonin Receptor (CALCR) Antibody

20-abx322776
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin Receptor (CALCR) Antibody

20-abx339721
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcitonin Receptor (CALCR) Antibody

abx412504-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Calcitonin Receptor (CALCR) Antibody

abx412505-10ug 10 ug
EUR 370
  • Shipped within 1 week.

Calcitonin Receptor (CALCR) Antibody

abx413817-01mg 0.1 mg
EUR 746
  • Shipped within 1 week.

Calcitonin Receptor (CALCR) Antibody

20-abx210505
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CALCR cloning plasmid

CSB-CL004439HU-10ug 10ug
EUR 509
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1425
  • Sequence: atgaggttcacatttacaagccggtgcttggcactgtttcttcttctaaatcacccaaccccaattcttcctgccttttcaaatcaaacctatccaacaatagagcccaagccatttctttacgtcgtaggacgaaagaagatgatggatgcacagtacaaatgctatgaccgaa
  • Show more
Description: A cloning plasmid for the CALCR gene.

CALCR Blocking Peptide

33R-6844 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CALCR antibody, catalog no. 70R-9835

CALCR Blocking Peptide

DF10202-BP 1mg
EUR 195

Rat CALCR shRNA Plasmid

20-abx987263
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCR ELISA KIT|Human

EF004696 96 Tests
EUR 689

Human CALCR shRNA Plasmid

20-abx950560
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CALCR shRNA Plasmid

20-abx969442
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CALCR Recombinant Protein (Human)

RP005461 100 ug Ask for price

CALCR Recombinant Protein (Rat)

RP192902 100 ug Ask for price

CALCR Recombinant Protein (Rat)

RP192905 100 ug Ask for price

CALCR Recombinant Protein (Mouse)

RP120812 100 ug Ask for price

CALCR Recombinant Protein (Mouse)

RP120815 100 ug Ask for price

CALCR ORF Vector (Human) (pORF)

ORF001821 1.0 ug DNA
EUR 95

Calcr ORF Vector (Mouse) (pORF)

ORF040272 1.0 ug DNA
EUR 506

Calcr ORF Vector (Mouse) (pORF)

ORF040273 1.0 ug DNA
EUR 506

Calcr ORF Vector (Rat) (pORF)

ORF064302 1.0 ug DNA
EUR 506

Calcr ORF Vector (Rat) (pORF)

ORF064303 1.0 ug DNA
EUR 506

Pig Calcitonin Receptor (CALCR) ELISA Kit

abx360605-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Calcitonin Receptor (CALCR) ELISA Kit

abx364277-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse Calcitonin receptor, Calcr ELISA KIT

ELI-10822m 96 Tests
EUR 865

Porcine Calcitonin receptor, CALCR ELISA KIT

ELI-10823p 96 Tests
EUR 928

Human Calcitonin receptor, CALCR ELISA KIT

ELI-11766h 96 Tests
EUR 824

CALCR sgRNA CRISPR Lentivector set (Human)

K0354801 3 x 1.0 ug
EUR 339

Human Calcitonin Receptor (CALCR) ELISA Kit

abx351378-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Calcitonin Receptor (CALCR) ELISA Kit

abx352533-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Monkey Calcitonin Receptor (CALCR) ELISA Kit

abx358875-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Calcitonin Receptor (CALCR) ELISA Kit

abx355652-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Calcitonin Receptor (CALCR) ELISA Kit

abx391053-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Calcr sgRNA CRISPR Lentivector set (Mouse)

K4540901 3 x 1.0 ug
EUR 339

Calcr sgRNA CRISPR Lentivector set (Rat)

K7000201 3 x 1.0 ug
EUR 339

Monoclonal CALCR / Calcitonin Receptor Antibody (clone 2F7), Clone: 2F7

AMM02230G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human CALCR / Calcitonin Receptor (clone 2F7). The antibodies are raised in Mouse and are from clone 2F7. This antibody is applicable in WB and IHC-P, E

CALCR sgRNA CRISPR Lentivector (Human) (Target 1)

K0354802 1.0 ug DNA
EUR 154

CALCR sgRNA CRISPR Lentivector (Human) (Target 2)

K0354803 1.0 ug DNA
EUR 154

CALCR sgRNA CRISPR Lentivector (Human) (Target 3)

K0354804 1.0 ug DNA
EUR 154

Guinea pig Calcitonin Receptor (CALCR) ELISA Kit

abx357668-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Calcr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4540902 1.0 ug DNA
EUR 154

Calcr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4540903 1.0 ug DNA
EUR 154

Calcr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4540904 1.0 ug DNA
EUR 154

Calcr sgRNA CRISPR Lentivector (Rat) (Target 1)

K7000202 1.0 ug DNA
EUR 154

Calcr sgRNA CRISPR Lentivector (Rat) (Target 2)

K7000203 1.0 ug DNA
EUR 154

Calcr sgRNA CRISPR Lentivector (Rat) (Target 3)

K7000204 1.0 ug DNA
EUR 154

CALCR Protein Vector (Human) (pPB-C-His)

PV007281 500 ng
EUR 329

CALCR Protein Vector (Human) (pPB-N-His)

PV007282 500 ng
EUR 329

CALCR Protein Vector (Human) (pPM-C-HA)

PV007283 500 ng
EUR 329

CALCR Protein Vector (Human) (pPM-C-His)

PV007284 500 ng
EUR 329

CALCR Protein Vector (Rat) (pPB-C-His)

PV257206 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPB-N-His)

PV257207 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPM-C-HA)

PV257208 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPM-C-His)

PV257209 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPB-C-His)

PV257210 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPB-N-His)

PV257211 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPM-C-HA)

PV257212 500 ng
EUR 603

CALCR Protein Vector (Rat) (pPM-C-His)

PV257213 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPB-C-His)

PV161086 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPB-N-His)

PV161087 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPM-C-HA)

PV161088 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPM-C-His)

PV161089 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPB-C-His)

PV161090 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPB-N-His)

PV161091 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPM-C-HA)

PV161092 500 ng
EUR 603

CALCR Protein Vector (Mouse) (pPM-C-His)

PV161093 500 ng
EUR 603

Calcr 3'UTR Luciferase Stable Cell Line

TU201583 1.0 ml Ask for price

Calcr 3'UTR GFP Stable Cell Line

TU153051 1.0 ml Ask for price

CALCR 3'UTR Luciferase Stable Cell Line

TU003396 1.0 ml
EUR 1521

Calcr 3'UTR Luciferase Stable Cell Line

TU103051 1.0 ml Ask for price

CALCR 3'UTR GFP Stable Cell Line

TU053396 1.0 ml
EUR 1521

Calcr 3'UTR GFP Stable Cell Line

TU251583 1.0 ml Ask for price

Calcr ELISA Kit| Rat Calcitonin receptor ELISA Kit

EF018406 96 Tests
EUR 689

Calcr ELISA Kit| Mouse Calcitonin receptor ELISA Kit

EF014360 96 Tests
EUR 689

CALCR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV680797 1.0 ug DNA
EUR 682

CALCR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV680801 1.0 ug DNA
EUR 682

CALCR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV680802 1.0 ug DNA
EUR 682

CALCR Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV680821 1.0 ug DNA
EUR 682

CALCR Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV680825 1.0 ug DNA
EUR 682

CALCR Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV680826 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

CALCR Rabbit Polyclonal Antibody