CDO1 Rabbit Polyclonal Antibody

CDO1 Polyclonal Antibody
ES10948-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CDO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDO1 Polyclonal Antibody
ES10948-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CDO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDO1 Rabbit pAb
A8402-100ul	Abclonal	100 ul	EUR 308

CDO1 Rabbit pAb
A8402-200ul	Abclonal	200 ul	EUR 459

CDO1 Rabbit pAb
A8402-20ul	Abclonal	20 ul	EUR 183

CDO1 Rabbit pAb
A8402-50ul	Abclonal	50 ul	EUR 223

CDO1 antibody
70R-16337	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CDO1 antibody

CDO1 Antibody
36337-100ul	SAB	100ul	EUR 252

CDO1 Antibody
1-CSB-PA005099GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDO1 Antibody
1-CSB-PA621975ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDO1 Antibody
DF10174	Affbiotech	200ul	EUR 304
Description: CDO1 Antibody detects endogenous levels of total CDO1.

CDO1 Antibody
1-CSB-PA438445	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody
1-CSB-PA203536	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody
ABD10174	Lifescience Market	100 ug	EUR 438

CDO1 Conjugated Antibody
C36337	SAB	100ul	EUR 397

Anti-CDO1 antibody
STJ110700	St John's Laboratory	100 µl	EUR 277

Anti-CDO1 antibody
STJ192106	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CDO1

Polyclonal Cysteine Dioxygenase / CDO1 Antibody (N-Terminus)
APR07473G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cysteine Dioxygenase / CDO1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse)
4-PAE248Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1)

CDO1 siRNA
20-abx900982	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDO1 siRNA
20-abx911336	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CDO1 siRNA
20-abx911337	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC
4-PAE248Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Biotinylated
4-PAE248Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Biotin.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Cy3
4-PAE248Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Cy3.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), FITC
4-PAE248Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with FITC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), HRP
4-PAE248Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with HRP.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), PE
4-PAE248Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with PE.

CDO1 Blocking Peptide
DF10174-BP	Affbiotech	1mg	EUR 195

CDO1 cloning plasmid
CSB-CL621975HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 603 Sequence: atggaacagaccgaagtgctgaagccacggaccctggctgatctgatccgcatcctgcaccagctctttgccggcgatgaggtcaatgtagaggaggtgcaggccatcatggaagcctacgagagcgaccccaccgagtgggcaatgtacgccaagttcgaccagtacaggtatac Show more
Description: A cloning plasmid for the CDO1 gene.

Human Cysteine Dioxygenase (CDO1) Antibody
35700-05111	AssayPro	150 ug	EUR 261

Cysteine Dioxygenase I (CDO1) Antibody
20-abx213747	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Antibody
20-abx213748	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Antibody
20-abx111889	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Antibody
20-abx129115	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cysteine Dioxygenase I (CDO1) Antibody
20-abx129778	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Human, Rat, Pig)
4-PAE248Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Cysteine Dioxygenase I (CDO1)

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAE248Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CDO1 (Met1~Asn200) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC-Cy7.

Rabbit Cysteine dioxygenase type 1(CDO1) ELISA kit
E04C1579-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cysteine dioxygenase type 1(CDO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cysteine dioxygenase type 1(CDO1) ELISA kit
E04C1579-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cysteine dioxygenase type 1(CDO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDO1 Rabbit Polyclonal Antibody