
셀타젠 Genetic Genotyping

CDO1 Rabbit Polyclonal Antibody

CDO1 Rabbit Polyclonal Antibody

CDO1 Polyclonal Antibody

ES10948-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CDO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDO1 Polyclonal Antibody

ES10948-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CDO1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CDO1 Rabbit pAb

A8402-100ul 100 ul
EUR 308

CDO1 Rabbit pAb

A8402-200ul 200 ul
EUR 459

CDO1 Rabbit pAb

A8402-20ul 20 ul
EUR 183

CDO1 Rabbit pAb

A8402-50ul 50 ul
EUR 223

CDO1 antibody

70R-16337 50 ul
EUR 435
Description: Rabbit polyclonal CDO1 antibody

CDO1 Antibody

36337-100ul 100ul
EUR 252

CDO1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CDO1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDO1 Antibody

DF10174 200ul
EUR 304
Description: CDO1 Antibody detects endogenous levels of total CDO1.

CDO1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CDO1. Recognizes CDO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

CDO1 Antibody

ABD10174 100 ug
EUR 438

CDO1 Conjugated Antibody

C36337 100ul
EUR 397

Anti-CDO1 antibody

STJ110700 100 µl
EUR 277

Anti-CDO1 antibody

STJ192106 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CDO1

Polyclonal Cysteine Dioxygenase / CDO1 Antibody (N-Terminus)

APR07473G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cysteine Dioxygenase / CDO1 (N-Terminus). This antibody is tested and proven to work in the following applications:

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Biotin.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with Cy3.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with FITC.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with HRP.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with PE.

CDO1 Blocking Peptide

DF10174-BP 1mg
EUR 195

CDO1 cloning plasmid

CSB-CL621975HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggaacagaccgaagtgctgaagccacggaccctggctgatctgatccgcatcctgcaccagctctttgccggcgatgaggtcaatgtagaggaggtgcaggccatcatggaagcctacgagagcgaccccaccgagtgggcaatgtacgccaagttcgaccagtacaggtatac
  • Show more
Description: A cloning plasmid for the CDO1 gene.

Human Cysteine Dioxygenase (CDO1) Antibody

35700-05111 150 ug
EUR 261

Cysteine Dioxygenase I (CDO1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cysteine Dioxygenase I (CDO1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cysteine Dioxygenase I (CDO1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Human, Rat, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Cysteine Dioxygenase I (CDO1)

Cysteine Dioxygenase I (CDO1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDO1 (Met1~Asn200)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Cysteine Dioxygenase I (CDO1). This antibody is labeled with APC-Cy7.

Rabbit Cysteine dioxygenase type 1(CDO1) ELISA kit

E04C1579-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cysteine dioxygenase type 1(CDO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cysteine dioxygenase type 1(CDO1) ELISA kit

E04C1579-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Cysteine dioxygenase type 1(CDO1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDO1 Rabbit Polyclonal Antibody