CDX4 Rabbit Polyclonal Antibody
CDX4 Polyclonal Antibody |
ABP58099-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CDX4 from Human, Mouse. This CDX4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDX4 protein at amino acid sequence of 30-110 |
CDX4 Polyclonal Antibody |
ES11267-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CDX4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CDX4 Polyclonal Antibody |
ES11267-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CDX4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CDX4 Rabbit pAb |
A2704-100ul |
Abclonal |
100 ul |
EUR 308 |
CDX4 Rabbit pAb |
A2704-200ul |
Abclonal |
200 ul |
EUR 459 |
CDX4 Rabbit pAb |
A2704-20ul |
Abclonal |
20 ul |
EUR 183 |
CDX4 Rabbit pAb |
A2704-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal CDX4 Antibody (Center) |
AMM08762G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (Center). This antibody is tested and proven to work in the following applications: |
CDX4 Antibody |
46947-100ul |
SAB |
100ul |
EUR 252 |
CDX4 Antibody |
45262-100ul |
SAB |
100ul |
EUR 252 |
CDX4 Antibody |
45262-50ul |
SAB |
50ul |
EUR 187 |
CDX4 Antibody |
1-CSB-PA005129LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
CDX4 Antibody |
DF8285 |
Affbiotech |
200ul |
EUR 304 |
Description: CDX4 Antibody detects endogenous levels of total CDX4. |
Polyclonal CDX4 Antibody (C-term) |
AMM08761G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CDX4 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Cdx4 antibody - C-terminal region |
AMM08763G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdx4 - C-terminal region. This antibody is tested and proven to work in the following applications: |
CDX4 Conjugated Antibody |
C45262 |
SAB |
100ul |
EUR 397 |
CDX4 Conjugated Antibody |
C46947 |
SAB |
100ul |
EUR 397 |
anti- CDX4 antibody |
FNab01574 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: caudal type homeobox 4
- Uniprot ID: O14627
- Gene ID: 1046
- Research Area: Epigenetics, Metabolism, Developmental biology
|
Description: Antibody raised against CDX4 |
Anti-CDX4 antibody |
STJ116185 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a small subfamily of homeobox containing transcription factors. The encoded protein may regulate homeobox gene expression during anteroposterior patterning and hematopoiesis. |
Anti-CDX4 antibody |
STJ192425 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CDX4 |
CDX4 siRNA |
20-abx911366 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDX4 siRNA |
20-abx911367 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDX4 Antibody, HRP conjugated |
1-CSB-PA005129LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CDX4 Antibody, FITC conjugated |
1-CSB-PA005129LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CDX4 Antibody, Biotin conjugated |
1-CSB-PA005129LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDX4. Recognizes CDX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CDX4 Blocking Peptide |
DF8285-BP |
Affbiotech |
1mg |
EUR 195 |
CDX4 cloning plasmid |
CSB-CL005129HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 855
- Sequence: ATGTACGGAAGCTGTCTTTTGGAGAAAGAAGCAGGCATGTACCCGGGCACTCTCATGAGCCCTGGGGGCGACGGCACAGCTGGGACAGGCGGCACAGGGGGCGGTGGGAGTCCGATGCCAGCCTCCAATTTCGCTGCGGCACCGGCTTTCTCGCACTATATGGGGTATCCTCATAT
- Show more
|
Description: A cloning plasmid for the CDX4 gene. |
Anti-Cdx4 (1G12) |
YF-MA12403 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1G12) |
YF-MA12404 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1H7) |
YF-MA12405 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (2E11) |
YF-MA12406 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (2G12) |
YF-MA12407 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (3H3) |
YF-MA12408 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (3F3) |
YF-MA12409 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1A11) |
YF-MA12410 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (2F8) |
YF-MA12411 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (3H8) |
YF-MA12412 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1H4) |
YF-MA12413 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (2H7) |
YF-MA12414 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1E9) |
YF-MA12415 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (3F11) |
YF-MA12416 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Anti-Cdx4 (1E11) |
YF-MA12417 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Cdx4 |
Mouse CDX4 shRNA Plasmid |
20-abx969634 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CDX4 shRNA Plasmid |
20-abx950755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CDX4 Recombinant Protein (Human) |
RP037975 |
ABM |
100 ug |
Ask for price |
CDX4 Recombinant Protein (Rat) |
RP194420 |
ABM |
100 ug |
Ask for price |
CDX4 Recombinant Protein (Mouse) |
RP123266 |
ABM |
100 ug |
Ask for price |
Homeobox Protein CDX-4 (CDX4) Antibody |
20-abx005973 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Homeobox Protein CDX-4 (CDX4) Antibody |
20-abx149178 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Homeobox Protein CDX-4 (CDX4) Antibody |
20-abx318143 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Caudal Type Homeobox 4 (CDX4) Antibody |
abx231574-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Caudal type homeo box transcription factor 4 (CDX4) polyclonal antibody |
ABP-PAB-10470 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Transcription Factors
- Brand:
|
Monoclonal CDX4 Antibody (monoclonal) (M06), Clone: 3F3 |
APR15399G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3F3. This antibody is applicable in WB, E |
Monoclonal CDX4 Antibody (monoclonal) (M08), Clone: 2F8 |
APR15400G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human CDX4 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 2F8. This antibody is applicable in WB, E |
Homeobox Protein CDX-4 (CDX4) Antibody (HRP) |
20-abx315635 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Homeobox Protein CDX-4 (CDX4) Antibody (FITC) |
20-abx315636 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Homeobox Protein CDX-4 (CDX4) Antibody (Biotin) |
20-abx315637 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cdx4 ORF Vector (Rat) (pORF) |
ORF064808 |
ABM |
1.0 ug DNA |
EUR 506 |
CDX4 ORF Vector (Human) (pORF) |
ORF012659 |
ABM |
1.0 ug DNA |
EUR 354 |
Cdx4 ORF Vector (Mouse) (pORF) |
ORF041090 |
ABM |
1.0 ug DNA |
EUR 506 |
CDX4 sgRNA CRISPR Lentivector set (Human) |
K0423601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cdx4 sgRNA CRISPR Lentivector set (Rat) |
K6479101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cdx4 sgRNA CRISPR Lentivector set (Mouse) |
K3909601 |
ABM |
3 x 1.0 ug |
EUR 339 |
CDX4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0423602 |
ABM |
1.0 ug DNA |
EUR 154 |
CDX4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0423603 |
ABM |
1.0 ug DNA |
EUR 154 |
CDX4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0423604 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6479102 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6479103 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdx4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6479104 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3909602 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3909603 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdx4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3909604 |
ABM |
1.0 ug DNA |
EUR 154 |
CDX4 Protein Vector (Mouse) (pPB-C-His) |
PV164358 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Mouse) (pPB-N-His) |
PV164359 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Mouse) (pPM-C-HA) |
PV164360 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Mouse) (pPM-C-His) |
PV164361 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Rat) (pPB-C-His) |
PV259230 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Rat) (pPB-N-His) |
PV259231 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Rat) (pPM-C-HA) |
PV259232 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Rat) (pPM-C-His) |
PV259233 |
ABM |
500 ng |
EUR 603 |
CDX4 Protein Vector (Human) (pPB-C-His) |
PV050633 |
ABM |
500 ng |
EUR 481 |
CDX4 Protein Vector (Human) (pPB-N-His) |
PV050634 |
ABM |
500 ng |
EUR 481 |
CDX4 Protein Vector (Human) (pPM-C-HA) |
PV050635 |
ABM |
500 ng |
EUR 481 |
CDX4 Protein Vector (Human) (pPM-C-His) |
PV050636 |
ABM |
500 ng |
EUR 481 |
Cdx4 3'UTR GFP Stable Cell Line |
TU153671 |
ABM |
1.0 ml |
Ask for price |
Cdx4 3'UTR Luciferase Stable Cell Line |
TU103671 |
ABM |
1.0 ml |
Ask for price |
Cdx4 3'UTR Luciferase Stable Cell Line |
TU202134 |
ABM |
1.0 ml |
Ask for price |
Cdx4 3'UTR GFP Stable Cell Line |
TU252134 |
ABM |
1.0 ml |
Ask for price |
CDX4 3'UTR GFP Stable Cell Line |
TU054126 |
ABM |
1.0 ml |
EUR 1394 |
CDX4 3'UTR Luciferase Stable Cell Line |
TU004126 |
ABM |
1.0 ml |
EUR 1394 |
Human Homeobox protein CDX- 4, CDX4 ELISA KIT |
ELI-25465h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Homeobox Protein CDX-4 (CDX4) ELISA Kit |
abx386449-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Homeobox protein CDX- 4, Cdx4 ELISA KIT |
ELI-33837m |
Lifescience Market |
96 Tests |
EUR 865 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
CDX4 Rabbit Polyclonal Antibody