CISD2 Rabbit Polyclonal Antibody
CISD2 Polyclonal Antibody |
ABP58160-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
- Applications tips:
|
Description: A polyclonal antibody for detection of CISD2 from Human, Mouse. This CISD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80 |
CISD2 Polyclonal Antibody |
ABP58160-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80
- Applications tips:
|
Description: A polyclonal antibody for detection of CISD2 from Human, Mouse. This CISD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CISD2 protein at amino acid sequence of 31-80 |
CISD2 Polyclonal Antibody |
A66626 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CISD2 Polyclonal Antibody |
30644-100ul |
SAB |
100ul |
EUR 252 |
CISD2 Polyclonal Antibody |
30644-50ul |
SAB |
50ul |
EUR 187 |
CISD2 Polyclonal Antibody |
28451-100ul |
SAB |
100ul |
EUR 252 |
CISD2 Polyclonal Antibody |
28451-50ul |
SAB |
50ul |
EUR 187 |
CISD2 Rabbit pAb |
A5231-100ul |
Abclonal |
100 ul |
EUR 308 |
CISD2 Rabbit pAb |
A5231-200ul |
Abclonal |
200 ul |
EUR 459 |
CISD2 Rabbit pAb |
A5231-20ul |
Abclonal |
20 ul |
EUR 183 |
CISD2 Rabbit pAb |
A5231-50ul |
Abclonal |
50 ul |
EUR 223 |
CISD2 Rabbit pAb |
A14168-100ul |
Abclonal |
100 ul |
EUR 308 |
CISD2 Rabbit pAb |
A14168-200ul |
Abclonal |
200 ul |
EUR 459 |
CISD2 Rabbit pAb |
A14168-20ul |
Abclonal |
20 ul |
EUR 183 |
CISD2 Rabbit pAb |
A14168-50ul |
Abclonal |
50 ul |
EUR 223 |
CISD2 Polyclonal Conjugated Antibody |
C30644 |
SAB |
100ul |
EUR 397 |
CISD2 Polyclonal Conjugated Antibody |
C28451 |
SAB |
100ul |
EUR 397 |
CISD2 antibody |
70R-6583 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CISD2 antibody raised against the N terminal of CISD2 |
CISD2 antibody |
70R-16427 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CISD2 antibody |
CISD2 Antibody |
DF12096 |
Affbiotech |
200ul |
EUR 304 |
Description: CISD2 antibody detects endogenous levels of CISD2. |
CISD2 Antibody |
1-CSB-PA005443GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CISD2 Antibody |
1-CSB-PA839803LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
CISD2 Polyclonal Antibody, HRP Conjugated |
A66627 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
CISD2 Polyclonal Antibody, FITC Conjugated |
A66628 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CISD2 Polyclonal Antibody, Biotin Conjugated |
A66629 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Polyclonal CISD2 antibody - N-terminal region |
APR15452G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CISD2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal NAF-1 / CISD2 Antibody (Internal) |
APR17526G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NAF-1 / CISD2 (Internal). This antibody is tested and proven to work in the following applications: |
anti- CISD2 antibody |
FNab01718 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: CDGSH iron sulfur domain 2
- Uniprot ID: Q8N5K1
- Gene ID: 493856
- Research Area: Signal Transduction
|
Description: Antibody raised against CISD2 |
CISD2-Specific Antibody |
abx231719-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-CISD2 antibody |
STJ27203 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a zinc finger protein that localizes to the endoplasmic reticulum. The encoded protein binds an iron/sulfur cluster and may be involved in calcium homeostasis. Defects in this gene are a cause of Wolfram syndrome 2. |
Anti-CISD2 antibody |
STJ192586 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CISD2 |
Anti-CISD2 antibody |
STJ116103 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a zinc finger protein that localizes to the endoplasmic reticulum. The encoded protein binds an iron/sulfur cluster and may be involved in calcium homeostasis. Defects in this gene are a cause of Wolfram syndrome 2. |
CISD2 siRNA |
20-abx911885 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CISD2 siRNA |
20-abx911886 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti- CISD2-Specific antibody |
FNab01719 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:2000-1:16000
- IHC: 1:20-1:200
- IF: 1:50-1:500
- Immunogen: CDGSH iron sulfur domain 2
- Uniprot ID: Q8N5K1
- Research Area: Signal Transduction
|
Description: Antibody raised against CISD2-Specific |
CISD2 Antibody, HRP conjugated |
1-CSB-PA839803LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CISD2 Antibody, FITC conjugated |
1-CSB-PA839803LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CISD2 Antibody, Biotin conjugated |
1-CSB-PA839803LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CISD2. Recognizes CISD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CISD2 Blocking Peptide |
33R-9652 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CISD2 antibody, catalog no. 70R-6583 |
CISD2 Blocking Peptide |
DF12096-BP |
Affbiotech |
1mg |
EUR 195 |
CISD2 cloning plasmid |
CSB-CL839803HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 408
- Sequence: atggtgctggagagcgtggcccgtatcgtgaaggtgcagctccctgcatatctgaagcggctcccagtccctgaaagcattaccgggttcgctaggctcacagtttcagaatggcttcggttattgcctttccttggtgtactcgcacttcttggctaccttgcagttcgtccatt
- Show more
|
Description: A cloning plasmid for the CISD2 gene. |
Mouse CISD2 shRNA Plasmid |
20-abx975914 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CISD2 shRNA Plasmid |
20-abx968356 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CISD2 Recombinant Protein (Human) |
RP007168 |
ABM |
100 ug |
Ask for price |
CISD2 Recombinant Protein (Rat) |
RP195095 |
ABM |
100 ug |
Ask for price |
CISD2 Recombinant Protein (Mouse) |
RP124238 |
ABM |
100 ug |
Ask for price |
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody |
20-abx111510 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody |
20-abx004018 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody |
20-abx317989 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody |
abx231718-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CISD2 ORF Vector (Human) (pORF) |
ORF002390 |
ABM |
1.0 ug DNA |
EUR 95 |
Cisd2 ORF Vector (Rat) (pORF) |
ORF065033 |
ABM |
1.0 ug DNA |
EUR 506 |
Cisd2 ORF Vector (Mouse) (pORF) |
ORF041414 |
ABM |
1.0 ug DNA |
EUR 506 |
CISD2 ELISA Kit (Mouse) (OKCA01642) |
OKCA01642 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Regulator of autophagy that contributes to antagonize BECN1-mediated cellular autophagy at the endoplasmic reticulum. Participates in the interaction of BCL2 with BECN1 and is required for BCL2-mediated depression of endoplasmic reticulum Ca2+ stores during autophagy. Contributes to BIK-initiated autophagy, while it is not involved in BIK-dependent activation of caspases. Involved in life span control, probably via its function as regulator of autophagy.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 11.75 pg/mL |
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody (HRP) |
20-abx309416 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody (FITC) |
20-abx309417 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CDGSH Iron Sulfur Domain 2 (CISD2) Antibody (Biotin) |
20-abx309418 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) ELISA kit |
E04C0925-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) ELISA kit |
E04C0925-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) ELISA kit |
E04C0925-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CDGSH iron sulfur domain containing protein 2(CISD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CISD2 sgRNA CRISPR Lentivector set (Human) |
K0454401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cisd2 sgRNA CRISPR Lentivector set (Rat) |
K6206601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cisd2 sgRNA CRISPR Lentivector set (Mouse) |
K4949301 |
ABM |
3 x 1.0 ug |
EUR 339 |
CISD2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0454402 |
ABM |
1.0 ug DNA |
EUR 154 |
CISD2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0454403 |
ABM |
1.0 ug DNA |
EUR 154 |
CISD2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0454404 |
ABM |
1.0 ug DNA |
EUR 154 |
Cisd2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6206602 |
ABM |
1.0 ug DNA |
EUR 154 |
Cisd2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6206603 |
ABM |
1.0 ug DNA |
EUR 154 |
Cisd2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6206604 |
ABM |
1.0 ug DNA |
EUR 154 |
Cisd2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4949302 |
ABM |
1.0 ug DNA |
EUR 154 |
Cisd2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4949303 |
ABM |
1.0 ug DNA |
EUR 154 |
Cisd2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4949304 |
ABM |
1.0 ug DNA |
EUR 154 |
CISD2 Protein Vector (Human) (pPB-C-His) |
PV009557 |
ABM |
500 ng |
EUR 329 |
CISD2 Protein Vector (Human) (pPB-N-His) |
PV009558 |
ABM |
500 ng |
EUR 329 |
CISD2 Protein Vector (Human) (pPM-C-HA) |
PV009559 |
ABM |
500 ng |
EUR 329 |
CISD2 Protein Vector (Human) (pPM-C-His) |
PV009560 |
ABM |
500 ng |
EUR 329 |
CISD2 Protein Vector (Rat) (pPB-C-His) |
PV260130 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Rat) (pPB-N-His) |
PV260131 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Rat) (pPM-C-HA) |
PV260132 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Rat) (pPM-C-His) |
PV260133 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Mouse) (pPB-C-His) |
PV165654 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Mouse) (pPB-N-His) |
PV165655 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Mouse) (pPM-C-HA) |
PV165656 |
ABM |
500 ng |
EUR 603 |
CISD2 Protein Vector (Mouse) (pPM-C-His) |
PV165657 |
ABM |
500 ng |
EUR 603 |
Cisd2 3'UTR Luciferase Stable Cell Line |
TU202372 |
ABM |
1.0 ml |
Ask for price |
Cisd2 3'UTR GFP Stable Cell Line |
TU153920 |
ABM |
1.0 ml |
Ask for price |
CISD2 3'UTR Luciferase Stable Cell Line |
TU004468 |
ABM |
1.0 ml |
EUR 1521 |
Cisd2 3'UTR Luciferase Stable Cell Line |
TU103920 |
ABM |
1.0 ml |
Ask for price |
CISD2 3'UTR GFP Stable Cell Line |
TU054468 |
ABM |
1.0 ml |
EUR 1521 |
Cisd2 3'UTR GFP Stable Cell Line |
TU252372 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
CISD2 Rabbit Polyclonal Antibody