CLN8 Rabbit Polyclonal Antibody
 CLN8 Polyclonal Antibody |
|
ES11417-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CLN8 Polyclonal Antibody |
|
ES11417-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CLN8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Antibody) Protein CLN8 (CLN8) Antibody |
|
abx030518-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Protein CLN8 (CLN8) Antibody |
|
abx030518-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 CLN8 Rabbit pAb |
|
A16843-100ul |
Abclonal |
100 ul |
EUR 308 |
CLN8 Rabbit pAb |
|
A16843-200ul |
Abclonal |
200 ul |
EUR 459 |
CLN8 Rabbit pAb |
|
A16843-20ul |
Abclonal |
20 ul |
EUR 183 |
CLN8 Rabbit pAb |
|
A16843-50ul |
Abclonal |
50 ul |
EUR 223 |
 CLN8 Polyclonal Conjugated Antibody |
|
C29954 |
SAB |
100ul |
EUR 397 |
 CLN8 Antibody |
|
1-CSB-PA866210LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
 CLN8 antibody |
|
70R-7114 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal CLN8 antibody |
CLN8 antibody |
|
70R-7115 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal CLN8 antibody |
) Polyclonal CLN8 Antibody (C-term) |
|
APG02662G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLN8 (C-term). This antibody is tested and proven to work in the following applications: |
 Anti-CLN8 antibody |
|
STJ192575 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CLN8 |
 CLN8 siRNA |
|
20-abx901117 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN8 siRNA |
|
20-abx912107 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CLN8 siRNA |
|
20-abx912108 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CLN8 Antibody, HRP conjugated |
|
1-CSB-PA866210LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CLN8 Antibody, FITC conjugated |
|
1-CSB-PA866210LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CLN8 Antibody, Biotin conjugated |
|
1-CSB-PA866210LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CLN8. Recognizes CLN8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 CLN8 Blocking Peptide |
|
33R-9526 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7115 |
CLN8 Blocking Peptide |
|
33R-6257 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CLN8 antibody, catalog no. 70R-7114 |
 CLN8 cloning plasmid |
|
CSB-CL866210HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 861
- Sequence: atgaatcctgcgagcgatgggggcacatcagagagcatttttgacctggactatgcatcctgggggatccgctccacgctgatggtcgctggctttgtcttctacttgggcgtctttgtggtctgccaccagctgtcctcttccctgaatgccacttaccgttctttggtggccag
- Show more
|
|
Description: A cloning plasmid for the CLN8 gene. |
 Rat CLN8 shRNA Plasmid |
|
20-abx989401 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse CLN8 shRNA Plasmid |
|
20-abx973766 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CLN8 shRNA Plasmid |
|
20-abx951432 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CLN8 Recombinant Protein (Human) |
|
RP007384 |
ABM |
100 ug |
Ask for price |
) CLN8 Recombinant Protein (Rat) |
|
RP195413 |
ABM |
100 ug |
Ask for price |
) CLN8 Recombinant Protein (Mouse) |
|
RP124760 |
ABM |
100 ug |
Ask for price |
 (pORF)) Cln8 ORF Vector (Rat) (pORF) |
|
ORF065139 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CLN8 ORF Vector (Human) (pORF) |
|
ORF002462 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Cln8 ORF Vector (Mouse) (pORF) |
|
ORF041588 |
ABM |
1.0 ug DNA |
EUR 506 |
) CLN8 sgRNA CRISPR Lentivector set (Human) |
|
K0467001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cln8 sgRNA CRISPR Lentivector set (Rat) |
|
K7233701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cln8 sgRNA CRISPR Lentivector set (Mouse) |
|
K4701101 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) CLN8 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0467002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CLN8 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0467003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CLN8 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0467004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cln8 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7233702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cln8 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7233703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cln8 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7233704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4701102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4701103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cln8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4701104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CLN8 Protein Vector (Mouse) (pPB-C-His) |
|
PV166350 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CLN8 Protein Vector (Mouse) (pPB-N-His) |
|
PV166351 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CLN8 Protein Vector (Mouse) (pPM-C-HA) |
|
PV166352 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CLN8 Protein Vector (Mouse) (pPM-C-His) |
|
PV166353 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CLN8 Protein Vector (Rat) (pPB-C-His) |
|
PV260554 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CLN8 Protein Vector (Rat) (pPB-N-His) |
|
PV260555 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CLN8 Protein Vector (Rat) (pPM-C-HA) |
|
PV260556 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CLN8 Protein Vector (Rat) (pPM-C-His) |
|
PV260557 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CLN8 Protein Vector (Human) (pPB-C-His) |
|
PV009845 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CLN8 Protein Vector (Human) (pPB-N-His) |
|
PV009846 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CLN8 Protein Vector (Human) (pPM-C-HA) |
|
PV009847 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CLN8 Protein Vector (Human) (pPM-C-His) |
|
PV009848 |
ABM |
500 ng |
EUR 329 |
 Cln8 3'UTR GFP Stable Cell Line |
|
TU154036 |
ABM |
1.0 ml |
Ask for price |
 Cln8 3'UTR Luciferase Stable Cell Line |
|
TU104036 |
ABM |
1.0 ml |
Ask for price |
Cln8 3'UTR Luciferase Stable Cell Line |
|
TU202485 |
ABM |
1.0 ml |
Ask for price |
Cln8 3'UTR GFP Stable Cell Line |
|
TU252485 |
ABM |
1.0 ml |
Ask for price |
 CLN8 3'UTR GFP Stable Cell Line |
|
TU054601 |
ABM |
1.0 ml |
EUR 4617 |
 CLN8 3'UTR Luciferase Stable Cell Line |
|
TU004601 |
ABM |
1.0 ml |
EUR 4617 |
 (CMV) (pLenti-GIII-CMV)) CLN8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV672871 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) CLN8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV672875 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) CLN8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV672876 |
ABM |
1.0 ug DNA |
EUR 514 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
CLN8 Rabbit Polyclonal Antibody
