셀타젠 Genetic Genotyping

CLUL1 Rabbit Polyclonal Antibody

CLUL1 Polyclonal Antibody

ABP58195-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CLUL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLUL1 from Human, Mouse, Rat. This CLUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLUL1 protein

CLUL1 Polyclonal Antibody

ABP58195-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CLUL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLUL1 from Human, Mouse, Rat. This CLUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLUL1 protein

CLUL1 Polyclonal Antibody

ABP58195-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CLUL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CLUL1 from Human, Mouse, Rat. This CLUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLUL1 protein

CLUL1 Antibody

46957-100ul 100ul
EUR 252

Polyclonal CLUL1 Antibody (C-term)

APR14095G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CLUL1 (C-term). This antibody is tested and proven to work in the following applications:

Clul1/ Rat Clul1 ELISA Kit

ELI-50186r 96 Tests
EUR 886

CLUL1 Conjugated Antibody

C46957 100ul
EUR 397

Anti-CLUL1 antibody

STJ192124 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CLUL1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


PVT17307 2 ug
EUR 231


YF-PA18373 50 ug
EUR 363
Description: Mouse polyclonal to CLUL1

CLUL1 cloning plasmid

CSB-CL620897HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: atgaagccgccactcttggtgtttattgtgtgtctgctgtggttgaaagacagtcactgcgcacccacttggaaggacaaaactgctatcagtgaaaacctgaagagtttttctgaggtgggggagatagatgcagatgaagaggtgaagaaggctttgactggtattaagcaaa
  • Show more
Description: A cloning plasmid for the CLUL1 gene.

Rabbit Clusterin like protein 1(CLUL1) ELISA kit

E04C1824-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Clusterin like protein 1(CLUL1) ELISA kit

E04C1824-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Clusterin like protein 1(CLUL1) ELISA kit

E04C1824-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


ELI-10611d 96 Tests
EUR 928


EF004773 96 Tests
EUR 689

Human CLUL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CLUL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CLUL1 Recombinant Protein (Human)

RP007420 100 ug Ask for price

CLUL1 Recombinant Protein (Rat)

RP195479 100 ug Ask for price

Clusterin Like Protein 1 (CLUL1) Antibody

abx030473-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Clusterin Like Protein 1 (CLUL1) Antibody

abx030473-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

CLUL1 ORF Vector (Human) (pORF)

ORF002474 1.0 ug DNA
EUR 95

Clul1 ORF Vector (Rat) (pORF)

ORF065161 1.0 ug DNA
EUR 506

CLUL1 sgRNA CRISPR Lentivector set (Human)

K0469901 3 x 1.0 ug
EUR 339

Clul1 sgRNA CRISPR Lentivector set (Rat)

K6289201 3 x 1.0 ug
EUR 339

CLUL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0469902 1.0 ug DNA
EUR 154

CLUL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0469903 1.0 ug DNA
EUR 154

CLUL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0469904 1.0 ug DNA
EUR 154

Clul1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6289202 1.0 ug DNA
EUR 154

Clul1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6289203 1.0 ug DNA
EUR 154

Clul1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6289204 1.0 ug DNA
EUR 154

CLUL1 Protein Vector (Human) (pPB-C-His)

PV009893 500 ng
EUR 329

CLUL1 Protein Vector (Human) (pPB-N-His)

PV009894 500 ng
EUR 329

CLUL1 Protein Vector (Human) (pPM-C-HA)

PV009895 500 ng
EUR 329

CLUL1 Protein Vector (Human) (pPM-C-His)

PV009896 500 ng
EUR 329

CLUL1 Protein Vector (Rat) (pPB-C-His)

PV260642 500 ng
EUR 603

CLUL1 Protein Vector (Rat) (pPB-N-His)

PV260643 500 ng
EUR 603

CLUL1 Protein Vector (Rat) (pPM-C-HA)

PV260644 500 ng
EUR 603

CLUL1 Protein Vector (Rat) (pPM-C-His)

PV260645 500 ng
EUR 603

Clul1 3'UTR Luciferase Stable Cell Line

TU202505 1.0 ml Ask for price

CLUL1 3'UTR Luciferase Stable Cell Line

TU004629 1.0 ml
EUR 1394

CLUL1 3'UTR GFP Stable Cell Line

TU054629 1.0 ml
EUR 1394

Clul1 3'UTR GFP Stable Cell Line

TU252505 1.0 ml Ask for price

Goat Clusterin like protein 1(CLUL1) ELISA kit

E06C1824-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Clusterin like protein 1(CLUL1) ELISA kit

E06C1824-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Clusterin like protein 1(CLUL1) ELISA kit

E06C1824-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Clusterin like protein 1(CLUL1) ELISA kit

E02C1824-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Clusterin like protein 1(CLUL1) ELISA kit

E02C1824-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Clusterin like protein 1(CLUL1) ELISA kit

E02C1824-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Clusterin like protein 1(CLUL1) ELISA kit

E03C1824-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Clusterin like protein 1(CLUL1) ELISA kit

E03C1824-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Clusterin like protein 1(CLUL1) ELISA kit

E03C1824-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Clusterin like protein 1(CLUL1) ELISA kit

E01C1824-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Clusterin like protein 1(CLUL1) ELISA kit

E01C1824-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Clusterin like protein 1(CLUL1) ELISA kit

E01C1824-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Clusterin like protein 1(CLUL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CLUL1 Rabbit Polyclonal Antibody