CNDP1 Rabbit Polyclonal Antibody

CNDP1 Polyclonal Antibody
ES11310-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
DLR-CNDP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RDR-CNDP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit
RD-CNDP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

CNDP1 Rabbit pAb
A7485-100ul	Abclonal	100 ul	EUR 308

CNDP1 Rabbit pAb
A7485-200ul	Abclonal	200 ul	EUR 459

CNDP1 Rabbit pAb
A7485-20ul	Abclonal	20 ul	EUR 183

CNDP1 Rabbit pAb
A7485-50ul	Abclonal	50 ul	EUR 223

Polyclonal CNDP1 Antibody (Center)
APR04238G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CNDP1 Antibody (Center)
APR04637G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

CNDP1 antibody
70R-10125	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal CNDP1 antibody

CNDP1 Antibody
36359-100ul	SAB	100ul	EUR 252

CNDP1 antibody
10R-3701	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CNDP1 antibody

CNDP1 Antibody
1-CSB-PA836242ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CNDP1 Antibody
1-CSB-PA836242ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CNDP1 Antibody
1-CSB-PA439589	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal CNDP1 Antibody (C-term)
APR06148G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications:

CNDP1 Conjugated Antibody
C36359	SAB	100ul	EUR 397

anti- CNDP1 antibody
FNab01794	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 IF: 1:20-1:200 Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family) Uniprot ID: Q96KN2 Gene ID: 84735 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CNDP1

Anti-CNDP1 antibody
PAab01794	Lifescience Market	100 ug	EUR 355

Anti-CNDP1 antibody
STJ29621	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.

Anti-CNDP1 antibody
STJ192468	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CNDP1

Cndp1/ Rat Cndp1 ELISA Kit
ELI-03928r	Lifescience Market	96 Tests	EUR 886

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human)
4-PAF388Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1)

CNDP1 protein
80R-4374	Fitzgerald	50 ug	EUR 457
Description: Purified Recombinant CNDP1 protein (His tagged)

CNDP1 siRNA
20-abx901140	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNDP1 siRNA
20-abx912223	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CNDP1 siRNA
20-abx912224	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CNDP1
YF-PA21472	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CNDP1

anti-CNDP1
YF-PA21473	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to CNDP1

anti-CNDP1
YF-PA21474	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CNDP1

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC
4-PAF388Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated
4-PAF388Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3
4-PAF388Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC
4-PAF388Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP
4-PAF388Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE
4-PAF388Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CNDP1 (Asp332~His507) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE.

CNDP1 Blocking Peptide
33R-3591	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125

CNDP1 cloning plasmid
CSB-CL836242HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 933 Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid
CSB-CL836242HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1527 Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid
CSB-CL836242HU3-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1524 Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca Show more
Description: A cloning plasmid for the CNDP1 gene.

Carnosine Dipeptidase 1 (CNDP1) Antibody
20-abx128272	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carnosine Dipeptidase 1 (CNDP1) Antibody
20-abx171590	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

CNDP1 Rabbit Polyclonal Antibody