CelltaGen
셀타젠 Genetic Genotyping

CNDP1 Rabbit Polyclonal Antibody

CNDP1 Polyclonal Antibody

ES11310-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

DLR-CNDP1-Hu-48T 48T
EUR 517
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

DLR-CNDP1-Hu-96T 96T
EUR 673
  • Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids.

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RDR-CNDP1-Hu-48Tests 48 Tests
EUR 544

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RDR-CNDP1-Hu-96Tests 96 Tests
EUR 756

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RD-CNDP1-Hu-48Tests 48 Tests
EUR 521

Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit

RD-CNDP1-Hu-96Tests 96 Tests
EUR 723

CNDP1 Rabbit pAb

A7485-100ul 100 ul
EUR 308

CNDP1 Rabbit pAb

A7485-200ul 200 ul
EUR 459

CNDP1 Rabbit pAb

A7485-20ul 20 ul
EUR 183

CNDP1 Rabbit pAb

A7485-50ul 50 ul
EUR 223

Polyclonal CNDP1 Antibody (Center)

APR04238G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal CNDP1 Antibody (Center)

APR04637G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications:

CNDP1 antibody

70R-10125 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CNDP1 antibody

CNDP1 Antibody

36359-100ul 100ul
EUR 252

CNDP1 antibody

10R-3701 100 ul
EUR 691
Description: Mouse monoclonal CNDP1 antibody

CNDP1 Antibody

1-CSB-PA836242ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

CNDP1 Antibody

1-CSB-PA836242ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CNDP1 Antibody

1-CSB-PA439589
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

Polyclonal CNDP1 Antibody (C-term)

APR06148G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications:

CNDP1 Conjugated Antibody

C36359 100ul
EUR 397

anti- CNDP1 antibody

FNab01794 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IF: 1:20-1:200
  • Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family)
  • Uniprot ID: Q96KN2
  • Gene ID: 84735
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CNDP1

Anti-CNDP1 antibody

PAab01794 100 ug
EUR 355

Anti-CNDP1 antibody

STJ29621 100 µl
EUR 277
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region.

Anti-CNDP1 antibody

STJ192468 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNDP1

Cndp1/ Rat Cndp1 ELISA Kit

ELI-03928r 96 Tests
EUR 886

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human)

4-PAF388Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1)

CNDP1 protein

80R-4374 50 ug
EUR 457
Description: Purified Recombinant CNDP1 protein (His tagged)

CNDP1 siRNA

20-abx901140
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNDP1 siRNA

20-abx912223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNDP1 siRNA

20-abx912224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CNDP1

YF-PA21472 50 ug
EUR 363
Description: Mouse polyclonal to CNDP1

anti-CNDP1

YF-PA21473 100 ul
EUR 403
Description: Rabbit polyclonal to CNDP1

anti-CNDP1

YF-PA21474 100 ug
EUR 403
Description: Rabbit polyclonal to CNDP1

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC

4-PAF388Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated

4-PAF388Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3

4-PAF388Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC

4-PAF388Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP

4-PAF388Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP.

Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE

4-PAF388Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNDP1 (Asp332~His507)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE.

CNDP1 Blocking Peptide

33R-3591 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125

CNDP1 cloning plasmid

CSB-CL836242HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 933
  • Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag
  • Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid

CSB-CL836242HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1527
  • Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg
  • Show more
Description: A cloning plasmid for the CNDP1 gene.

CNDP1 cloning plasmid

CSB-CL836242HU3-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1524
  • Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca
  • Show more
Description: A cloning plasmid for the CNDP1 gene.

Carnosine Dipeptidase 1 (CNDP1) Antibody

20-abx128272
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Carnosine Dipeptidase 1 (CNDP1) Antibody

20-abx171590
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

CNDP1 Rabbit Polyclonal Antibody