CNDP1 Rabbit Polyclonal Antibody
CNDP1 Polyclonal Antibody |
ES11310-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CNDP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
DLR-CNDP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
DLR-CNDP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Carnosine Dipeptidase 1 (CNDP1) in samples from serum, plasma, cerebrospinal fluid or other biological fluids. |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RDR-CNDP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RDR-CNDP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RD-CNDP1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Carnosine Dipeptidase 1 (CNDP1) ELISA Kit |
RD-CNDP1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
CNDP1 Rabbit pAb |
A7485-100ul |
Abclonal |
100 ul |
EUR 308 |
CNDP1 Rabbit pAb |
A7485-200ul |
Abclonal |
200 ul |
EUR 459 |
CNDP1 Rabbit pAb |
A7485-20ul |
Abclonal |
20 ul |
EUR 183 |
CNDP1 Rabbit pAb |
A7485-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal CNDP1 Antibody (Center) |
APR04238G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal CNDP1 Antibody (Center) |
APR04637G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (Center). This antibody is tested and proven to work in the following applications: |
CNDP1 antibody |
70R-10125 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CNDP1 antibody |
CNDP1 Antibody |
36359-100ul |
SAB |
100ul |
EUR 252 |
CNDP1 antibody |
10R-3701 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CNDP1 antibody |
CNDP1 Antibody |
1-CSB-PA836242ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
CNDP1 Antibody |
1-CSB-PA836242ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
CNDP1 Antibody |
1-CSB-PA439589 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CNDP1. Recognizes CNDP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
Polyclonal CNDP1 Antibody (C-term) |
APR06148G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNDP1 (C-term). This antibody is tested and proven to work in the following applications: |
CNDP1 Conjugated Antibody |
C36359 |
SAB |
100ul |
EUR 397 |
anti- CNDP1 antibody |
FNab01794 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IF: 1:20-1:200
- Immunogen: carnosine dipeptidase 1(metallopeptidase M20 family)
- Uniprot ID: Q96KN2
- Gene ID: 84735
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against CNDP1 |
Anti-CNDP1 antibody |
STJ29621 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the M20 metalloprotease family. The encoded protein is specifically expressed in the brain, is a homodimeric dipeptidase which was identified as human carnosinase. This gene contains trinucleotide (CTG) repeat length polymorphism in the coding region. |
Anti-CNDP1 antibody |
STJ192468 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CNDP1 |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human) |
4-PAF388Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1) |
CNDP1 protein |
80R-4374 |
Fitzgerald |
50 ug |
EUR 457 |
Description: Purified Recombinant CNDP1 protein (His tagged) |
CNDP1 siRNA |
20-abx901140 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNDP1 siRNA |
20-abx912223 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNDP1 siRNA |
20-abx912224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CNDP1 |
YF-PA21472 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CNDP1 |
anti-CNDP1 |
YF-PA21473 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to CNDP1 |
anti-CNDP1 |
YF-PA21474 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CNDP1 |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), APC |
4-PAF388Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with APC. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Biotinylated |
4-PAF388Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Biotin. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), Cy3 |
4-PAF388Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with Cy3. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), FITC |
4-PAF388Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with FITC. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), HRP |
4-PAF388Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with HRP. |
Carnosine Dipeptidase 1 (CNDP1) Polyclonal Antibody (Human), PE |
4-PAF388Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNDP1 (Asp332~His507)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Carnosine Dipeptidase 1 (CNDP1). This antibody is labeled with PE. |
CNDP1 Blocking Peptide |
33R-3591 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CNDP1 antibody, catalog no. 70R-10125 |
CNDP1 cloning plasmid |
CSB-CL836242HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 933
- Sequence: atggaagaggctggctctgttgccctggaggaacttgtggaaaaagaaaaggaccgattcttctctggtgtggactacattgtaatttcagataacctgtggatcagccaaaggaagccagcaatcacttatggaacccgggggaacagctacttcatggtggaggtgaaatgcag
- Show more
|
Description: A cloning plasmid for the CNDP1 gene. |
CNDP1 cloning plasmid |
CSB-CL836242HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1527
- Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtgg
- Show more
|
Description: A cloning plasmid for the CNDP1 gene. |
CNDP1 cloning plasmid |
CSB-CL836242HU3-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1524
- Sequence: atggatcccaaactcgggagaatggctgcgtccctgctggctgtgctgctgctgctgctggagcgcggcatgttctcctcaccctccccgcccccggcgctgttagagaaagtcttccagtacattgacctccatcaggatgaatttgtgcagacgctgaaggagtgggtggcca
- Show more
|
Description: A cloning plasmid for the CNDP1 gene. |
Carnosine Dipeptidase 1 (CNDP1) Antibody |
20-abx128272 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Carnosine Dipeptidase 1 (CNDP1) Antibody |
20-abx171590 |
Abbexa |
|
|
|
CNDP1 Rabbit Polyclonal Antibody