CRNN Rabbit Polyclonal Antibody

Human Cornulin (CRNN) ELISA Kit
RDR-CRNN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Cornulin (CRNN) ELISA Kit
RD-CRNN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cornulin (CRNN) ELISA Kit
RD-CRNN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

CRNN Polyclonal Antibody
ES11317-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CRNN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CRNN Polyclonal Antibody
ES11317-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CRNN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CRNN Polyclonal Antibody
ABP58273-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460 Applications tips:
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460

CRNN Polyclonal Antibody
ABP58273-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460 Applications tips:
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460

CRNN Polyclonal Antibody
ABP58273-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460 Applications tips:
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460

CRNN Polyclonal Antibody
A58666	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CRNN Polyclonal Antibody
31637-100ul	SAB	100ul	EUR 252

CRNN Polyclonal Antibody
31637-50ul	SAB	50ul	EUR 187

CRNN Rabbit pAb
A8762-100ul	Abclonal	100 ul	EUR 308

CRNN Rabbit pAb
A8762-200ul	Abclonal	200 ul	EUR 459

CRNN Rabbit pAb
A8762-20ul	Abclonal	20 ul	EUR 183

CRNN Rabbit pAb
A8762-50ul	Abclonal	50 ul	EUR 223

CRNN Polyclonal Conjugated Antibody
C31637	SAB	100ul	EUR 397

CRNN antibody
70R-16597	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CRNN antibody

CRNN Antibody
1-CSB-PA005988GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CRNN Antibody
1-CSB-PA005988HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CRNN Polyclonal Antibody, Biotin Conjugated
A58667	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CRNN Polyclonal Antibody, FITC Conjugated
A58668	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

CRNN Polyclonal Antibody, HRP Conjugated
A58669	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Rabbit Cornulin(CRNN) ELISA kit
E04C2076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cornulin(CRNN) ELISA kit
E04C2076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cornulin(CRNN) ELISA kit
E04C2076-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti- CRNN antibody
FNab01991	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200-1:1000 IHC: 1:20-1:200 Immunogen: cornulin Uniprot ID: Q9UBG3 Gene ID: 49860 Research Area: cancer, Signal Transduction
Description: Antibody raised against CRNN

Cornulin (CRNN) Antibody
20-abx123857	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Cornulin (CRNN) Antibody
20-abx111803	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cornulin (CRNN) Antibody
20-abx176014	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Cornulin (CRNN) Antibody
20-abx318815	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cornulin (CRNN) Antibody
abx231991-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Cornulin (CRNN) Antibody
20-abx171925	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Anti-CRNN antibody
PAab01991	Lifescience Market	100 ug	EUR 386

Anti-CRNN antibody
STJ111406	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the 'fused gene' family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation.

Anti-CRNN antibody
STJ192475	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CRNN

CRNN siRNA
20-abx912836	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cornulin (CRNN) Antibody (HRP)
20-abx303500	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cornulin (CRNN) Antibody (FITC)
20-abx303501	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Cornulin (CRNN) Antibody (Biotin)
20-abx303502	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CRNN Antibody, HRP conjugated
1-CSB-PA005988HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CRNN Antibody, FITC conjugated
1-CSB-PA005988HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CRNN Antibody, Biotin conjugated
1-CSB-PA005988HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CRNN cloning plasmid
CSB-CL005988HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1488 Sequence: atgcctcagttactgcaaaacattaatgggatcatcgaggccttcaggcgctatgcaaggacggagggcaactgcacagcgctcacccgaggggagctgaaaagactcttggagcaagagtttgccgatgtgattgtgaaaccccacgatccagcaactgtggatgaggtcctgc Show more
Description: A cloning plasmid for the CRNN gene.

Cornulin (CRNN) Protein
20-abx260579	Abbexa	EUR 2861.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

Human Cornulin (CRNN) Protein
20-abx653055	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

CRNN ELISA KIT|Human
EF008854	Lifescience Market	96 Tests	EUR 689

Human CRNN shRNA Plasmid
20-abx959368	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CRNN protein (His tag)
80R-1268	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human CRNN protein

CRNN Recombinant Protein (Human)
RP008047	ABM	100 ug	Ask for price

CRNN Recombinant Protein (Mouse)
RP126086	ABM	100 ug	Ask for price

Human Cornulin (CRNN) CLIA Kit
20-abx495692	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Goat Cornulin(CRNN) ELISA kit
E06C2076-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cornulin(CRNN) ELISA kit
E06C2076-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CRNN Rabbit Polyclonal Antibody