CRNN Rabbit Polyclonal Antibody
Human Cornulin (CRNN) ELISA Kit |
RDR-CRNN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Cornulin (CRNN) ELISA Kit |
RD-CRNN-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cornulin (CRNN) ELISA Kit |
RD-CRNN-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
CRNN Polyclonal Antibody |
ES11317-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CRNN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CRNN Polyclonal Antibody |
ES11317-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CRNN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CRNN Polyclonal Antibody |
ABP58273-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460 |
CRNN Polyclonal Antibody |
ABP58273-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460 |
CRNN Polyclonal Antibody |
ABP58273-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460 |
CRNN Polyclonal Antibody |
A58666 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
CRNN Polyclonal Antibody |
31637-100ul |
SAB |
100ul |
EUR 252 |
CRNN Polyclonal Antibody |
31637-50ul |
SAB |
50ul |
EUR 187 |
CRNN Rabbit pAb |
A8762-100ul |
Abclonal |
100 ul |
EUR 308 |
CRNN Rabbit pAb |
A8762-200ul |
Abclonal |
200 ul |
EUR 459 |
CRNN Rabbit pAb |
A8762-20ul |
Abclonal |
20 ul |
EUR 183 |
CRNN Rabbit pAb |
A8762-50ul |
Abclonal |
50 ul |
EUR 223 |
CRNN Polyclonal Conjugated Antibody |
C31637 |
SAB |
100ul |
EUR 397 |
CRNN antibody |
70R-16597 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CRNN antibody |
CRNN Antibody |
1-CSB-PA005988GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
CRNN Antibody |
1-CSB-PA005988HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
CRNN Polyclonal Antibody, Biotin Conjugated |
A58667 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CRNN Polyclonal Antibody, FITC Conjugated |
A58668 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CRNN Polyclonal Antibody, HRP Conjugated |
A58669 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Rabbit Cornulin(CRNN) ELISA kit |
E04C2076-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cornulin(CRNN) ELISA kit |
E04C2076-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cornulin(CRNN) ELISA kit |
E04C2076-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
anti- CRNN antibody |
FNab01991 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: cornulin
- Uniprot ID: Q9UBG3
- Gene ID: 49860
- Research Area: cancer, Signal Transduction
|
Description: Antibody raised against CRNN |
Cornulin (CRNN) Antibody |
20-abx123857 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cornulin (CRNN) Antibody |
20-abx111803 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cornulin (CRNN) Antibody |
20-abx176014 |
Abbexa |
|
|
|
Cornulin (CRNN) Antibody |
20-abx318815 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cornulin (CRNN) Antibody |
abx231991-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Cornulin (CRNN) Antibody |
20-abx171925 |
Abbexa |
|
|
|
Anti-CRNN antibody |
STJ111406 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the 'fused gene' family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. |
Anti-CRNN antibody |
STJ192475 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CRNN |
CRNN siRNA |
20-abx912836 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cornulin (CRNN) Antibody (HRP) |
20-abx303500 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cornulin (CRNN) Antibody (FITC) |
20-abx303501 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cornulin (CRNN) Antibody (Biotin) |
20-abx303502 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CRNN Antibody, HRP conjugated |
1-CSB-PA005988HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CRNN Antibody, FITC conjugated |
1-CSB-PA005988HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CRNN Antibody, Biotin conjugated |
1-CSB-PA005988HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CRNN cloning plasmid |
CSB-CL005988HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1488
- Sequence: atgcctcagttactgcaaaacattaatgggatcatcgaggccttcaggcgctatgcaaggacggagggcaactgcacagcgctcacccgaggggagctgaaaagactcttggagcaagagtttgccgatgtgattgtgaaaccccacgatccagcaactgtggatgaggtcctgc
- Show more
|
Description: A cloning plasmid for the CRNN gene. |
Cornulin (CRNN) Protein |
20-abx260579 |
Abbexa |
-
EUR 2861.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Cornulin (CRNN) Protein |
20-abx653055 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human CRNN shRNA Plasmid |
20-abx959368 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CRNN protein (His tag) |
80R-1268 |
Fitzgerald |
100 ug |
EUR 268 |
Description: Purified recombinant Human CRNN protein |
CRNN Recombinant Protein (Human) |
RP008047 |
ABM |
100 ug |
Ask for price |
CRNN Recombinant Protein (Mouse) |
RP126086 |
ABM |
100 ug |
Ask for price |
Human Cornulin (CRNN) CLIA Kit |
20-abx495692 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Goat Cornulin(CRNN) ELISA kit |
E06C2076-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Cornulin(CRNN) ELISA kit |
E06C2076-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CRNN Rabbit Polyclonal Antibody