CelltaGen
셀타젠 Genetic Genotyping

CRNN Rabbit Polyclonal Antibody

Human Cornulin (CRNN) ELISA Kit

RDR-CRNN-Hu-96Tests 96 Tests
EUR 756

Human Cornulin (CRNN) ELISA Kit

RD-CRNN-Hu-48Tests 48 Tests
EUR 521

Human Cornulin (CRNN) ELISA Kit

RD-CRNN-Hu-96Tests 96 Tests
EUR 723

CRNN Polyclonal Antibody

ES11317-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CRNN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CRNN Polyclonal Antibody

ES11317-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CRNN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CRNN Polyclonal Antibody

ABP58273-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460

CRNN Polyclonal Antibody

ABP58273-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460

CRNN Polyclonal Antibody

ABP58273-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of CRNN from Human. This CRNN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CRNN protein at amino acid sequence of 380-460

CRNN Polyclonal Antibody

A58666 100 µg
EUR 570.55
Description: Ask the seller for details

CRNN Polyclonal Antibody

31637-100ul 100ul
EUR 252

CRNN Polyclonal Antibody

31637-50ul 50ul
EUR 187

CRNN Rabbit pAb

A8762-100ul 100 ul
EUR 308

CRNN Rabbit pAb

A8762-200ul 200 ul
EUR 459

CRNN Rabbit pAb

A8762-20ul 20 ul
EUR 183

CRNN Rabbit pAb

A8762-50ul 50 ul
EUR 223

CRNN Polyclonal Conjugated Antibody

C31637 100ul
EUR 397

CRNN antibody

70R-16597 50 ul
EUR 435
Description: Rabbit polyclonal CRNN antibody

CRNN Antibody

1-CSB-PA005988GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

CRNN Antibody

1-CSB-PA005988HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

CRNN Polyclonal Antibody, Biotin Conjugated

A58667 100 µg
EUR 570.55
Description: The best epigenetics products

CRNN Polyclonal Antibody, FITC Conjugated

A58668 100 µg
EUR 570.55
Description: kits suitable for this type of research

CRNN Polyclonal Antibody, HRP Conjugated

A58669 100 µg
EUR 570.55
Description: fast delivery possible

Rabbit Cornulin(CRNN) ELISA kit

E04C2076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cornulin(CRNN) ELISA kit

E04C2076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cornulin(CRNN) ELISA kit

E04C2076-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti- CRNN antibody

FNab01991 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: cornulin
  • Uniprot ID: Q9UBG3
  • Gene ID: 49860
  • Research Area: cancer, Signal Transduction
Description: Antibody raised against CRNN

Cornulin (CRNN) Antibody

20-abx123857
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cornulin (CRNN) Antibody

20-abx111803
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cornulin (CRNN) Antibody

20-abx176014
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cornulin (CRNN) Antibody

20-abx318815
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cornulin (CRNN) Antibody

abx231991-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Cornulin (CRNN) Antibody

20-abx171925
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-CRNN antibody

PAab01991 100 ug
EUR 386

Anti-CRNN antibody

STJ111406 100 µl
EUR 277
Description: This gene encodes a member of the 'fused gene' family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation.

Anti-CRNN antibody

STJ192475 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CRNN

CRNN siRNA

20-abx912836
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Cornulin (CRNN) Antibody (HRP)

20-abx303500
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cornulin (CRNN) Antibody (FITC)

20-abx303501
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cornulin (CRNN) Antibody (Biotin)

20-abx303502
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CRNN Antibody, HRP conjugated

1-CSB-PA005988HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CRNN Antibody, FITC conjugated

1-CSB-PA005988HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CRNN Antibody, Biotin conjugated

1-CSB-PA005988HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRNN. Recognizes CRNN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CRNN cloning plasmid

CSB-CL005988HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1488
  • Sequence: atgcctcagttactgcaaaacattaatgggatcatcgaggccttcaggcgctatgcaaggacggagggcaactgcacagcgctcacccgaggggagctgaaaagactcttggagcaagagtttgccgatgtgattgtgaaaccccacgatccagcaactgtggatgaggtcctgc
  • Show more
Description: A cloning plasmid for the CRNN gene.

Cornulin (CRNN) Protein

20-abx260579
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Cornulin (CRNN) Protein

20-abx653055
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CRNN ELISA KIT|Human

EF008854 96 Tests
EUR 689

Human CRNN shRNA Plasmid

20-abx959368
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CRNN protein (His tag)

80R-1268 100 ug
EUR 268
Description: Purified recombinant Human CRNN protein

CRNN Recombinant Protein (Human)

RP008047 100 ug Ask for price

CRNN Recombinant Protein (Mouse)

RP126086 100 ug Ask for price

Human Cornulin (CRNN) CLIA Kit

20-abx495692
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Goat Cornulin(CRNN) ELISA kit

E06C2076-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cornulin(CRNN) ELISA kit

E06C2076-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cornulin(CRNN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CRNN Rabbit Polyclonal Antibody