DDC Rabbit Polyclonal Antibody
 Polyclonal DDC Antibody |
|
APR07525G |
Leading Biology |
0.1 mg |
EUR 659 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC . This antibody is tested and proven to work in the following applications: |
 DDC Polyclonal Antibody |
|
ES11130-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against DDC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DDC Polyclonal Antibody |
|
ES11130-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DDC from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ELISA Kit) Human Dopa Decarboxylase (DDC) ELISA Kit |
|
DLR-DDC-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Dopa Decarboxylase (DDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
DLR-DDC-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Dopa Decarboxylase (DDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
RDR-DDC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
RDR-DDC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
RD-DDC-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
RD-DDC-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 DDC Rabbit pAb |
|
A3828-100ul |
Abclonal |
100 ul |
EUR 308 |
DDC Rabbit pAb |
|
A3828-200ul |
Abclonal |
200 ul |
EUR 459 |
DDC Rabbit pAb |
|
A3828-20ul |
Abclonal |
20 ul |
EUR 183 |
DDC Rabbit pAb |
|
A3828-50ul |
Abclonal |
50 ul |
EUR 223 |
 Rabbit DDC ELISA Kit |
|
ERTD0239 |
Abclonal |
96Tests |
EUR 521 |
) Polyclonal DDC Antibody (N-term) |
|
APR07526G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC (N-term). This antibody is tested and proven to work in the following applications: |
 DDC antibody |
|
70R-16773 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal DDC antibody |
DDC antibody |
|
70R-1296 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal DDC antibody |
DDC antibody |
|
70R-14962 |
Fitzgerald |
100 ul |
EUR 392 |
|
Description: Rabbit polyclonal DDC antibody |
 DDC Antibody |
|
43464-100ul |
SAB |
100ul |
EUR 252 |
DDC Antibody |
|
43658-100ul |
SAB |
100ul |
EUR 252 |
DDC Antibody |
|
1-CSB-PA006583GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against DDC. Recognizes DDC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DDC Antibody |
|
1-CSB-PA006583LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
DDC antibody |
|
70R-3369 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal DDC antibody |
 Polyclonal DDC antibody - N-terminal region |
|
APR07527G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC - N-terminal region. This antibody is tested and proven to work in the following applications: |
) DDC antibody (Bovine) |
|
70R-14960 |
Fitzgerald |
100 ul |
EUR 392 |
|
Description: Rabbit polyclonal DDC antibody (Bovine) |
DDC antibody (Bovine) |
|
70R-14961 |
Fitzgerald |
100 ul |
EUR 392 |
|
Description: Sheep polyclonal DDC antibody (Bovine) |
 DDC Conjugated Antibody |
|
C43464 |
SAB |
100ul |
EUR 397 |
DDC Conjugated Antibody |
|
C43658 |
SAB |
100ul |
EUR 397 |
 Anti-DDC antibody |
|
STJ23355 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. |
Anti-DDC antibody |
|
STJ192288 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DDC |
) Polyclonal DDC / DOPA Decarboxylase Antibody (C-Terminus) |
|
APR07513G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC / DOPA Decarboxylase (C-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal DDC / DOPA Decarboxylase Antibody (N-Terminus) |
|
APR07524G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC / DOPA Decarboxylase (N-Terminus). This antibody is tested and proven to work in the following applications: |
 Polyclonal Antibody (Human, Bovine)) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine) |
|
4-PAG474Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC) |
 ELISA Kit) Rabbit Dopamine Decarboxylase (DDC) ELISA Kit |
|
abx363630-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 DDC siRNA |
|
20-abx901446 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DDC siRNA |
|
20-abx913737 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DDC siRNA |
|
20-abx913738 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 DDC Antibody, HRP conjugated |
|
1-CSB-PA006583LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DDC Antibody, FITC conjugated |
|
1-CSB-PA006583LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DDC Antibody, Biotin conjugated |
|
1-CSB-PA006583LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Antibody) Dopamine Decarboxylase (DDC) Antibody |
|
20-abx002777 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dopamine Decarboxylase (DDC) Antibody |
|
20-abx112157 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Dopa Decarboxylase (DDC) Antibody |
|
20-abx128444 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dopa Decarboxylase (DDC) Antibody |
|
20-abx172148 |
Abbexa |
|
|
|
|
Dopamine Decarboxylase (DDC) Antibody |
|
abx411983-01ml |
Abbexa |
0.1 ml |
EUR 704 |
|
|
 Antibody) DOPA Decarboxylase (DDC) Antibody |
|
abx432618-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
DOPA Decarboxylase (DDC) Antibody |
|
abx232510-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Human, Bovine), APC) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), APC |
|
4-PAG474Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Bovine), Biotinylated) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), Biotinylated |
|
4-PAG474Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Bovine), Cy3) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), Cy3 |
|
4-PAG474Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Bovine), FITC) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), FITC |
|
4-PAG474Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Bovine), HRP) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), HRP |
|
4-PAG474Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Bovine), PE) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), PE |
|
4-PAG474Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with PE. |
 DDC Blocking Peptide |
|
33R-2411 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDC antibody, catalog no. 70R-1296 |
DDC Blocking Peptide |
|
33R-8603 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDC antibody, catalog no. 70R-3369 |
 DDC cloning plasmid |
|
CSB-CL006583HU-10ug |
Cusabio |
10ug |
EUR 514 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1443
- Sequence: atgaacgcaagtgaattccgaaggagagggaaggagatggtggattacgtggccaactacatggaaggcattgagggacgccaggtctaccctgacgtggagcccgggtacctgcggccgctgatccctgccgctgcccctcaggagccagacacgtttgaggacatcatcaacg
- Show more
|
|
Description: A cloning plasmid for the DDC gene. |
) Anti-DDC (8E8) |
|
YF-MA20317 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DDC |
 Antibody) Human DOPA Decarboxylase (DDC) Antibody |
|
32682-05111 |
AssayPro |
150 ug |
EUR 261 |
 Polyclonal Antibody (Human, Bovine), APC-Cy7) Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), APC-Cy7 |
|
4-PAG474Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DDC (Leu200~Asn420)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with APC-Cy7. |
 antiserum # 2) Rabbit Anti-Human Dopamine Decarboxylase (DDC) antiserum # 2 |
|
DDC12-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
 Human DDC ELISA Kit |
|
EHD0239 |
Abclonal |
96Tests |
EUR 521 |
 Goat DDC ELISA Kit |
|
EGTD0239 |
Abclonal |
96Tests |
EUR 521 |
 Bovine DDC ELISA Kit |
|
EBD0239 |
Abclonal |
96Tests |
EUR 521 |
 Canine DDC ELISA Kit |
|
ECD0239 |
Abclonal |
96Tests |
EUR 521 |
 Anserini DDC ELISA Kit |
|
EAD0239 |
Abclonal |
96Tests |
EUR 521 |
 Rat DDC shRNA Plasmid |
|
20-abx984433 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse DDC shRNA Plasmid |
|
20-abx969967 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DDC shRNA Plasmid |
|
20-abx951158 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse DDC ELISA Kit |
|
EMD0239 |
Abclonal |
96Tests |
EUR 521 |
 Rat DDC ELISA Kit |
|
ERD0239 |
Abclonal |
96Tests |
EUR 521 |
 Porcine DDC ELISA Kit |
|
EPD0239 |
Abclonal |
96Tests |
EUR 521 |
) Recombinant Dopa Decarboxylase (DDC) |
|
4-RPG474Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20711
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.2kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Dopa Decarboxylase expressed in: E.coli |
) DDC Recombinant Protein (Human) |
|
RP054303 |
ABM |
100 ug |
Ask for price |
) DDC Recombinant Protein (Rat) |
|
RP197543 |
ABM |
100 ug |
Ask for price |
) DDC Recombinant Protein (Mouse) |
|
RP128270 |
ABM |
100 ug |
Ask for price |
DDC Recombinant Protein (Mouse) |
|
RP128273 |
ABM |
100 ug |
Ask for price |
 ELISA kit) Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit |
|
E04A1091-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit |
|
E04A1091-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit |
|
E04A1091-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody (Biotin Conjugate)) Human DOPA Decarboxylase (DDC) Antibody (Biotin Conjugate) |
|
32682-05121 |
AssayPro |
150 ug |
EUR 369 |
 Antibody) Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody |
|
20-abx302246 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 IgG # 2, aff pure) Rabbit Anti-Human Dopamine Decarboxylase (DDC) IgG # 2, aff pure |
|
DDC12-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
 Protein) Human Dopa Decarboxylase (DDC) Protein |
|
20-abx166730 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
 Guinea Pig DDC ELISA Kit |
|
EGD0239 |
Abclonal |
96Tests |
EUR 521 |
 (pORF)) Ddc ORF Vector (Rat) (pORF) |
|
ORF065849 |
ABM |
1.0 ug DNA |
EUR 506 |
 h DDC inducible lentiviral particles |
|
LVP891 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
|
Description: Pre-made over-expression lentivirus for expressing human target: DDC (dopa decarboxylase), [alternative names: AADC]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000790.3 . It also contains a RFP-Blasticidin dual selection marker. |
 (pORF)) DDC ORF Vector (Human) (pORF) |
|
ORF018102 |
ABM |
1.0 ug DNA |
EUR 405 |
 (pORF)) Ddc ORF Vector (Mouse) (pORF) |
|
ORF042758 |
ABM |
1.0 ug DNA |
EUR 506 |
Ddc ORF Vector (Mouse) (pORF) |
|
ORF042759 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD02490)) DDC ELISA Kit (Human) (OKCD02490) |
|
OKCD02490 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL |
 (OKEH05497)) DDC ELISA Kit (Mouse) (OKEH05497) |
|
OKEH05497 |
Aviva Systems Biology |
96 Wells |
EUR 766 |
|
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL |
 (OKEH06172)) DDC ELISA Kit (Rat) (OKEH06172) |
|
OKEH06172 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
 AssayLite Antibody (FITC Conjugate)) Human DOPA Decarboxylase (DDC) AssayLite Antibody (FITC Conjugate) |
|
32682-05141 |
AssayPro |
150 ug |
EUR 428 |
 AssayLite Antibody (RPE Conjugate)) Human DOPA Decarboxylase (DDC) AssayLite Antibody (RPE Conjugate) |
|
32682-05151 |
AssayPro |
150 ug |
EUR 428 |
 AssayLite Antibody (APC Conjugate)) Human DOPA Decarboxylase (DDC) AssayLite Antibody (APC Conjugate) |
|
32682-05161 |
AssayPro |
150 ug |
EUR 428 |
 AssayLite Antibody (PerCP Conjugate)) Human DOPA Decarboxylase (DDC) AssayLite Antibody (PerCP Conjugate) |
|
32682-05171 |
AssayPro |
150 ug |
EUR 471 |
 Antibody (HRP)) Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (HRP) |
|
20-abx315663 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (FITC) |
|
20-abx315664 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (Biotin) |
|
20-abx315665 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Human dopamine decarboxylase,DDC ELISA Kit |
|
201-12-0886 |
SunredBio |
96 tests |
EUR 440 |
- This dopamine decarboxylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 control peptide) Human Dopamine Decarboxylase (DDC) control peptide |
|
DDC11-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
 CLIA Kit) Human Dopamine Decarboxylase (DDC) CLIA Kit |
|
abx196611-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Dopamine Decarboxylase (DDC) ELISA Kit |
|
abx252328-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human dopamine decarboxylase,DDC ELISA Kit |
|
CN-04501H1 |
ChemNorm |
96T |
EUR 447 |
Human dopamine decarboxylase,DDC ELISA Kit |
|
CN-04501H2 |
ChemNorm |
48T |
EUR 296 |
 ELISA Kit) Pig Dopamine Decarboxylase (DDC) ELISA Kit |
|
abx360760-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Dopamine Decarboxylase (DDC) ELISA Kit |
|
abx358953-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Dopamine Decarboxylase (DDC) ELISA Kit |
|
abx355778-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
20-abx571107 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
 ELISA Kit) Cow Dopa Decarboxylase (DDC) ELISA Kit |
|
abx516891-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
abx516892-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse Dopa Decarboxylase (DDC) ELISA Kit |
|
abx516893-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Dopa Decarboxylase (DDC) ELISA Kit |
|
abx516894-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Dopa Decarboxylase (DDC) ELISA Kit |
|
abx516895-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 CLIA Kit) Human Dopa Decarboxylase (DDC) CLIA Kit |
|
20-abx495210 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
ELISA Kit) Rat dopamine decarboxylase(DDC)ELISA Kit |
|
GA-E0811RT-48T |
GenAsia Biotech |
48T |
EUR 317 |
Rat dopamine decarboxylase(DDC)ELISA Kit |
|
GA-E0811RT-96T |
GenAsia Biotech |
96T |
EUR 496 |
ELISA Kit) Human dopamine decarboxylase(DDC)ELISA Kit |
|
GA-E0902HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human dopamine decarboxylase(DDC)ELISA Kit |
|
GA-E0902HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
ELISA Kit) Mouse dopamine decarboxylase(DDC)ELISA Kit |
|
GA-E0986MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse dopamine decarboxylase(DDC)ELISA Kit |
|
GA-E0986MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
) DDC sgRNA CRISPR Lentivector set (Human) |
|
K0569001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ddc sgRNA CRISPR Lentivector set (Rat) |
|
K6903801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ddc sgRNA CRISPR Lentivector set (Mouse) |
|
K3768401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
SEG474Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
SEG474Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
SEG474Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
SEG474Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids. |
Human Dopa Decarboxylase (DDC) ELISA Kit |
|
4-SEG474Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Dopa Decarboxylase elisa. Alternative names of the recognized antigen: AADC
- Aromatic L-Amino Acid Decarboxylase
- DOPA decarboxylase
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) CLIA kit for Human DDC (Dopamine Decarboxylase) |
|
E-CL-H0798 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's DDC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DDC . Standards or samples are added to the micro CLIA plate wells and combined with the sp
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human DDC (Dopamine Decarboxylase) in samples from Serum, Plasma, Cell supernatant |
) ELISA kit for Human DDC (Dopamine Decarboxylase) |
|
E-EL-H1230 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's DDC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DDC. Standards or samples are added to the micro ELISA plate wells and combined with the
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human DDC (Dopamine Decarboxylase) in samples from Serum, Plasma, Cell supernatant |
 control peptide # 2) Human Dopamine Decarboxylase (DDC) control peptide # 2 |
|
DDC12-P |
Alpha Diagnostics |
100 ug |
EUR 164 |
) ELISA kit for Human DDC (Dopa Decarboxylase) |
|
ELK3653 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dopa Decarboxylase (DDC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dopa Deca
- Show more
|
|
Description: A sandwich ELISA kit for detection of Dopa Decarboxylase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 (Target 1)) DDC sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0569002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DDC sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0569003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DDC sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0569004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ddc sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6903802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ddc sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6903803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ddc sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6903804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ddc sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3768402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ddc sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3768403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ddc sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3768404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DDC Protein Vector (Mouse) (pPB-C-His) |
|
PV171030 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DDC Protein Vector (Mouse) (pPB-N-His) |
|
PV171031 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DDC Protein Vector (Mouse) (pPM-C-HA) |
|
PV171032 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DDC Protein Vector (Mouse) (pPM-C-His) |
|
PV171033 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPB-C-His) |
|
PV171034 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPB-N-His) |
|
PV171035 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPM-C-HA) |
|
PV171036 |
ABM |
500 ng |
EUR 603 |
DDC Protein Vector (Mouse) (pPM-C-His) |
|
PV171037 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DDC Protein Vector (Rat) (pPB-C-His) |
|
PV263394 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DDC Protein Vector (Rat) (pPB-N-His) |
|
PV263395 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DDC Protein Vector (Rat) (pPM-C-HA) |
|
PV263396 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DDC Protein Vector (Rat) (pPM-C-His) |
|
PV263397 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DDC Protein Vector (Human) (pPB-C-His) |
|
PV072405 |
ABM |
500 ng |
EUR 552 |
 (pPB-N-His)) DDC Protein Vector (Human) (pPB-N-His) |
|
PV072406 |
ABM |
500 ng |
EUR 552 |
 (pPM-C-HA)) DDC Protein Vector (Human) (pPM-C-HA) |
|
PV072407 |
ABM |
500 ng |
EUR 552 |
 (pPM-C-His)) DDC Protein Vector (Human) (pPM-C-His) |
|
PV072408 |
ABM |
500 ng |
EUR 552 |
 Ddc 3'UTR GFP Stable Cell Line |
|
TU154934 |
ABM |
1.0 ml |
Ask for price |
 Ddc 3'UTR Luciferase Stable Cell Line |
|
TU104934 |
ABM |
1.0 ml |
Ask for price |
Ddc 3'UTR Luciferase Stable Cell Line |
|
TU203228 |
ABM |
1.0 ml |
Ask for price |
Ddc 3'UTR GFP Stable Cell Line |
|
TU253228 |
ABM |
1.0 ml |
Ask for price |
 DDC 3'UTR GFP Stable Cell Line |
|
TU055656 |
ABM |
1.0 ml |
EUR 1394 |
 DDC 3'UTR Luciferase Stable Cell Line |
|
TU005656 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
DDC Rabbit Polyclonal Antibody
