셀타젠 Genetic Genotyping

DDC Rabbit Polyclonal Antibody

DDC Polyclonal Antibody

ABP58339-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DDC protein
  • Applications tips:
Description: A polyclonal antibody for detection of DDC from Human, Mouse, Rat. This DDC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDC protein

DDC Polyclonal Antibody

ABP58339-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DDC protein
  • Applications tips:
Description: A polyclonal antibody for detection of DDC from Human, Mouse, Rat. This DDC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDC protein

DDC Polyclonal Antibody

ABP58339-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DDC protein
  • Applications tips:
Description: A polyclonal antibody for detection of DDC from Human, Mouse, Rat. This DDC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDC protein

Human Dopa Decarboxylase (DDC) ELISA Kit

DLR-DDC-Hu-48T 48T
EUR 517
  • Should the Human Dopa Decarboxylase (DDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dopa Decarboxylase (DDC) ELISA Kit

DLR-DDC-Hu-96T 96T
EUR 673
  • Should the Human Dopa Decarboxylase (DDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Dopa Decarboxylase (DDC) ELISA Kit

RDR-DDC-Hu-48Tests 48 Tests
EUR 544

Human Dopa Decarboxylase (DDC) ELISA Kit

RDR-DDC-Hu-96Tests 96 Tests
EUR 756

Human Dopa Decarboxylase (DDC) ELISA Kit

RD-DDC-Hu-48Tests 48 Tests
EUR 521

Human Dopa Decarboxylase (DDC) ELISA Kit

RD-DDC-Hu-96Tests 96 Tests
EUR 723

DDC Rabbit pAb

A3828-100ul 100 ul
EUR 308

DDC Rabbit pAb

A3828-200ul 200 ul
EUR 459

DDC Rabbit pAb

A3828-20ul 20 ul
EUR 183

DDC Rabbit pAb

A3828-50ul 50 ul
EUR 223

Rabbit DDC ELISA Kit

ERTD0239 96Tests
EUR 521

Polyclonal DDC Antibody (N-term)

APR07526G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC (N-term). This antibody is tested and proven to work in the following applications:

DDC antibody

70R-3369 50 ug
EUR 467
Description: Rabbit polyclonal DDC antibody

DDC Antibody

43464-100ul 100ul
EUR 252

DDC Antibody

43658-100ul 100ul
EUR 252

DDC antibody

70R-1296 100 ug
EUR 377
Description: Rabbit polyclonal DDC antibody

DDC antibody

70R-14962 100 ul
EUR 392
Description: Rabbit polyclonal DDC antibody

DDC antibody

70R-16773 50 ul
EUR 435
Description: Rabbit polyclonal DDC antibody

DDC Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DDC. Recognizes DDC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DDC Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal DDC antibody - N-terminal region

APR07527G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC - N-terminal region. This antibody is tested and proven to work in the following applications:

DDC Conjugated Antibody

C43464 100ul
EUR 397

DDC Conjugated Antibody

C43658 100ul
EUR 397

DDC antibody (Bovine)

70R-14960 100 ul
EUR 392
Description: Rabbit polyclonal DDC antibody (Bovine)

DDC antibody (Bovine)

70R-14961 100 ul
EUR 392
Description: Sheep polyclonal DDC antibody (Bovine)

Anti-DDC antibody

STJ23355 100 µl
EUR 277
Description: The encoded protein catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. Defects in this gene are the cause of aromatic L-amino-acid decarboxylase deficiency (AADCD). AADCD deficiency is an inborn error in neurotransmitter metabolism that leads to combined serotonin and catecholamine deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene.

Anti-DDC antibody

STJ192288 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DDC

Ddc/ Rat Ddc ELISA Kit

ELI-04671r 96 Tests
EUR 886

Polyclonal DDC / DOPA Decarboxylase Antibody (C-Terminus)

APR07513G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC / DOPA Decarboxylase (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal DDC / DOPA Decarboxylase Antibody (N-Terminus)

APR07524G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DDC / DOPA Decarboxylase (N-Terminus). This antibody is tested and proven to work in the following applications:

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC)

Rabbit Dopamine Decarboxylase (DDC) ELISA Kit

abx363630-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Dopamine Decarboxylase (DDC) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dopa Decarboxylase (DDC) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dopamine Decarboxylase (DDC) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dopa Decarboxylase (DDC) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

DOPA Decarboxylase (DDC) Antibody

abx432618-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dopamine Decarboxylase (DDC) Antibody

abx411983-01ml 0.1 ml
EUR 704
  • Shipped within 1 week.

DOPA Decarboxylase (DDC) Antibody

abx232510-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DDC Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DDC Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DDC Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDC. Recognizes DDC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with APC.

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with Biotin.

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with Cy3.

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with FITC.

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with HRP.

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with PE.

DDC cloning plasmid

CSB-CL006583HU-10ug 10ug
EUR 514
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1443
  • Sequence: atgaacgcaagtgaattccgaaggagagggaaggagatggtggattacgtggccaactacatggaaggcattgagggacgccaggtctaccctgacgtggagcccgggtacctgcggccgctgatccctgccgctgcccctcaggagccagacacgtttgaggacatcatcaacg
  • Show more
Description: A cloning plasmid for the DDC gene.

DDC Blocking Peptide

33R-2411 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDC antibody, catalog no. 70R-1296

DDC Blocking Peptide

33R-8603 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDC antibody, catalog no. 70R-3369

Anti-DDC (8E8)

YF-MA20317 100 ug
EUR 363
Description: Mouse monoclonal to DDC

Human DOPA Decarboxylase (DDC) Antibody

32682-05111 150 ug
EUR 261

Dopa Decarboxylase (DDC) Polyclonal Antibody (Human, Bovine), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DDC (Leu200~Asn420)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Bovine Dopa Decarboxylase (DDC). This antibody is labeled with APC-Cy7.

Rabbit Anti-Human Dopamine Decarboxylase (DDC) antiserum # 2

DDC12-S 100 ul
EUR 457

Rat DDC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EHD0239 96Tests
EUR 521


EGTD0239 96Tests
EUR 521

Canine DDC ELISA Kit

ECD0239 96Tests
EUR 521

Bovine DDC ELISA Kit

EBD0239 96Tests
EUR 521

Anserini DDC ELISA Kit

EAD0239 96Tests
EUR 521


EF005926 96 Tests
EUR 689

Porcine DDC ELISA Kit

EPD0239 96Tests
EUR 521


ERD0239 96Tests
EUR 521


EMD0239 96Tests
EUR 521

Human DDC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DDC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Dopa Decarboxylase (DDC)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20711
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dopa Decarboxylase expressed in: E.coli

DDC Recombinant Protein (Human)

RP054303 100 ug Ask for price

DDC Recombinant Protein (Rat)

RP197543 100 ug Ask for price

DDC Recombinant Protein (Mouse)

RP128270 100 ug Ask for price

DDC Recombinant Protein (Mouse)

RP128273 100 ug Ask for price

Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit

E04A1091-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit

E04A1091-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aromatic L amino acid decarboxylase(DDC) ELISA kit

E04A1091-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Aromatic L amino acid decarboxylase(DDC) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human DOPA Decarboxylase (DDC) Antibody (Biotin Conjugate)

32682-05121 150 ug
EUR 369

Rabbit Anti-Human Dopamine Decarboxylase (DDC) IgG # 2, aff pure

DDC12-A 100 ug
EUR 482

Guinea Pig DDC ELISA Kit

EGD0239 96Tests
EUR 521

Human Dopa Decarboxylase (DDC) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Ddc ORF Vector (Rat) (pORF)

ORF065849 1.0 ug DNA
EUR 506

h DDC inducible lentiviral particles

LVP891 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: DDC (dopa decarboxylase), [alternative names: AADC]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_000790.3 . It also contains a RFP-Blasticidin dual selection marker.

Ddc ORF Vector (Mouse) (pORF)

ORF042758 1.0 ug DNA
EUR 506

Ddc ORF Vector (Mouse) (pORF)

ORF042759 1.0 ug DNA
EUR 506

DDC ORF Vector (Human) (pORF)

ORF018102 1.0 ug DNA
EUR 405

pECMV-Ddc-m-FLAG Plasmid

PVT15375 2 ug
EUR 325

DDC ELISA Kit (Human) (OKCD02490)

OKCD02490 96 Wells
EUR 831
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

DDC ELISA Kit (Mouse) (OKEH05497)

OKEH05497 96 Wells
EUR 766
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.092 ng/mL

DDC ELISA Kit (Rat) (OKEH06172)

OKEH06172 96 Wells
EUR 662
Description: Description of target: Catalyzes the decarboxylation of L-3,4-dihydroxyphenylalanine (DOPA) to dopamine, L-5-hydroxytryptophan to serotonin and L-tryptophan to tryptamine. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Aromatic-L-Amino-Acid Decarboxylase (DDC) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human DOPA Decarboxylase (DDC) AssayLite Antibody (FITC Conjugate)

32682-05141 150 ug
EUR 428

Human DOPA Decarboxylase (DDC) AssayLite Antibody (RPE Conjugate)

32682-05151 150 ug
EUR 428

Human DOPA Decarboxylase (DDC) AssayLite Antibody (APC Conjugate)

32682-05161 150 ug
EUR 428

Human DOPA Decarboxylase (DDC) AssayLite Antibody (PerCP Conjugate)

32682-05171 150 ug
EUR 471

Cow Dopa Decarboxylase (DDC) ELISA Kit

abx516891-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dopa Decarboxylase (DDC) ELISA Kit

abx516892-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Dopa Decarboxylase (DDC) ELISA Kit

abx516893-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Dopa Decarboxylase (DDC) ELISA Kit

abx516894-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Dopa Decarboxylase (DDC) ELISA Kit

abx516895-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Dopamine Decarboxylase (DDC) ELISA Kit

abx360760-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Dopa Decarboxylase (DDC) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human dopamine decarboxylase(DDC)ELISA Kit

GA-E0902HM-48T 48T
EUR 289

Human dopamine decarboxylase(DDC)ELISA Kit

GA-E0902HM-96T 96T
EUR 466

Mouse dopamine decarboxylase(DDC)ELISA Kit

GA-E0986MS-48T 48T
EUR 336

Mouse dopamine decarboxylase(DDC)ELISA Kit

GA-E0986MS-96T 96T
EUR 534

Rat dopamine decarboxylase(DDC)ELISA Kit

GA-E0811RT-48T 48T
EUR 317

Rat dopamine decarboxylase(DDC)ELISA Kit

GA-E0811RT-96T 96T
EUR 496

DDC sgRNA CRISPR Lentivector set (Human)

K0569001 3 x 1.0 ug
EUR 339

Human Dopamine Decarboxylase (DDC) CLIA Kit

abx196611-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Dopamine Decarboxylase (DDC) ELISA Kit

abx358953-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Dopamine Decarboxylase (DDC) ELISA Kit

abx355778-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Dopa Decarboxylase (DDC) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Dopamine Decarboxylase (DDC) ELISA Kit

abx252328-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human dopamine decarboxylase,DDC ELISA Kit

201-12-0886 96 tests
EUR 440
  • This dopamine decarboxylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Ddc sgRNA CRISPR Lentivector set (Mouse)

K3768401 3 x 1.0 ug
EUR 339

Human Dopamine Decarboxylase (DDC) control peptide

DDC11-P 100 ug
EUR 164

Human dopamine decarboxylase,DDC ELISA Kit

CN-04501H1 96T
EUR 447

Human dopamine decarboxylase,DDC ELISA Kit

CN-04501H2 48T
EUR 296

Ddc sgRNA CRISPR Lentivector set (Rat)

K6903801 3 x 1.0 ug
EUR 339

Human dopamine decarboxylase(DDC)ELISA Kit

QY-E03744 96T
EUR 361

Rat dopamine decarboxylase(DDC)ELISA Kit

QY-E10841 96T
EUR 361

Mouse dopamine decarboxylase(DDC)ELISA Kit

QY-E20487 96T
EUR 361

Human Dopa Decarboxylase (DDC) ELISA Kit

SEG474Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids.

Human Dopa Decarboxylase (DDC) ELISA Kit

SEG474Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids.

Human Dopa Decarboxylase (DDC) ELISA Kit

SEG474Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids.

Human Dopa Decarboxylase (DDC) ELISA Kit

SEG474Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dopa Decarboxylase (DDC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dopa Decarboxylase (DDC) in tissue homogenates, cell lysates and other biological fluids.

Human Dopa Decarboxylase (DDC) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dopa Decarboxylase elisa. Alternative names of the recognized antigen: AADC
  • Aromatic L-Amino Acid Decarboxylase
  • DOPA decarboxylase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dopa Decarboxylase (DDC) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human DDC (Dopa Decarboxylase)

ELK3653 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dopa Decarboxylase (DDC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dopa Deca
  • Show more
Description: A sandwich ELISA kit for detection of Dopa Decarboxylase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

DDC sgRNA CRISPR Lentivector (Human) (Target 1)

K0569002 1.0 ug DNA
EUR 154

DDC sgRNA CRISPR Lentivector (Human) (Target 2)

K0569003 1.0 ug DNA
EUR 154

DDC sgRNA CRISPR Lentivector (Human) (Target 3)

K0569004 1.0 ug DNA
EUR 154

Ddc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3768402 1.0 ug DNA
EUR 154

Ddc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3768403 1.0 ug DNA
EUR 154

Ddc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3768404 1.0 ug DNA
EUR 154

CLIA kit for Human DDC (Dopamine Decarboxylase)

E-CL-H0798 1 plate of 96 wells
EUR 584
  • Gentaur's DDC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DDC . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DDC (Dopamine Decarboxylase) in samples from Serum, Plasma, Cell supernatant

Human Dopamine Decarboxylase (DDC) control peptide # 2

DDC12-P 100 ug
EUR 164

ELISA kit for Human DDC (Dopamine Decarboxylase)

E-EL-H1230 1 plate of 96 wells
EUR 534
  • Gentaur's DDC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DDC. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DDC (Dopamine Decarboxylase) in samples from Serum, Plasma, Cell supernatant

Ddc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6903802 1.0 ug DNA
EUR 154

Ddc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6903803 1.0 ug DNA
EUR 154

Ddc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6903804 1.0 ug DNA
EUR 154

DDC Protein Vector (Human) (pPB-C-His)

PV072405 500 ng
EUR 552

DDC Protein Vector (Human) (pPB-N-His)

PV072406 500 ng
EUR 552

DDC Protein Vector (Human) (pPM-C-HA)

PV072407 500 ng
EUR 552

DDC Protein Vector (Human) (pPM-C-His)

PV072408 500 ng
EUR 552

DDC Protein Vector (Mouse) (pPB-C-His)

PV171030 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPB-N-His)

PV171031 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPM-C-HA)

PV171032 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPM-C-His)

PV171033 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPB-C-His)

PV171034 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPB-N-His)

PV171035 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPM-C-HA)

PV171036 500 ng
EUR 603

DDC Protein Vector (Mouse) (pPM-C-His)

PV171037 500 ng
EUR 603

DDC Protein Vector (Rat) (pPB-C-His)

PV263394 500 ng
EUR 603

DDC Protein Vector (Rat) (pPB-N-His)

PV263395 500 ng
EUR 603

DDC Protein Vector (Rat) (pPM-C-HA)

PV263396 500 ng
EUR 603

DDC Protein Vector (Rat) (pPM-C-His)

PV263397 500 ng
EUR 603

Ddc 3'UTR Luciferase Stable Cell Line

TU203228 1.0 ml Ask for price

Ddc 3'UTR GFP Stable Cell Line

TU154934 1.0 ml Ask for price

DDC 3'UTR Luciferase Stable Cell Line

TU005656 1.0 ml
EUR 1394

Ddc 3'UTR Luciferase Stable Cell Line

TU104934 1.0 ml Ask for price

DDC 3'UTR GFP Stable Cell Line

TU055656 1.0 ml
EUR 1394

Ddc 3'UTR GFP Stable Cell Line

TU253228 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

DDC Rabbit Polyclonal Antibody