DISP1 Rabbit Polyclonal Antibody
DISP1 Polyclonal Antibody |
ABP58376-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
- Applications tips:
|
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 |
DISP1 Polyclonal Antibody |
ABP58376-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
- Applications tips:
|
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 |
DISP1 Polyclonal Antibody |
28772-100ul |
SAB |
100ul |
EUR 252 |
DISP1 Polyclonal Antibody |
28772-50ul |
SAB |
50ul |
EUR 187 |
DISP1 Rabbit pAb |
A14946-100ul |
Abclonal |
100 ul |
EUR 308 |
DISP1 Rabbit pAb |
A14946-200ul |
Abclonal |
200 ul |
EUR 459 |
DISP1 Rabbit pAb |
A14946-20ul |
Abclonal |
20 ul |
EUR 183 |
DISP1 Rabbit pAb |
A14946-50ul |
Abclonal |
50 ul |
EUR 223 |
DISP1 Polyclonal Conjugated Antibody |
C28772 |
SAB |
100ul |
EUR 397 |
DISP1 antibody |
70R-6341 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DISP1 antibody |
DISP1 Antibody |
25400-100ul |
SAB |
100ul |
EUR 390 |
DISP1 antibody |
70R-16842 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DISP1 antibody |
DISP1 Antibody |
1-CSB-PA006916GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal DISP1 antibody - middle region |
APR11736G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications: |
Polyclonal DISPA / DISP1 Antibody (N-Terminus) |
APR11737G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications: |
anti- DISP1 antibody |
FNab02398 |
FN Test |
100µg |
EUR 585 |
- Immunogen: dispatched homolog 1(Drosophila)
- Uniprot ID: Q96F81
- Gene ID: 84976
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against DISP1 |
Anti-DISP1 antibody |
STJ117145 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. |
Anti-DISP1 antibody |
STJ192460 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DISP1 |
DISP1 siRNA |
20-abx914188 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DISP1 siRNA |
20-abx914189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse) |
4-PAN612Mu01 |
Cloud-Clone |
-
EUR 266.00
-
EUR 2813.00
-
EUR 694.00
-
EUR 337.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1) |
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC |
4-PAN612Mu01-APC |
Cloud-Clone |
-
EUR 374.00
-
EUR 3689.00
-
EUR 1016.00
-
EUR 481.00
-
EUR 232.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC. |
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAN612Mu01-Biotin |
Cloud-Clone |
-
EUR 332.00
-
EUR 2763.00
-
EUR 803.00
-
EUR 411.00
-
EUR 228.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin. |
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3 |
4-PAN612Mu01-Cy3 |
Cloud-Clone |
-
EUR 457.00
-
EUR 4877.00
-
EUR 1313.00
-
EUR 600.00
-
EUR 267.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3. |
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC |
4-PAN612Mu01-FITC |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC. |
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP |
4-PAN612Mu01-HRP |
Cloud-Clone |
-
EUR 341.00
-
EUR 3213.00
-
EUR 897.00
-
EUR 433.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP. |
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE |
4-PAN612Mu01-PE |
Cloud-Clone |
-
EUR 319.00
-
EUR 2971.00
-
EUR 832.00
-
EUR 405.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE. |
DISP1 Blocking Peptide |
33R-3115 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341 |
DISP1 cloning plasmid |
CSB-CL839320HU2-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1629
- Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta
- Show more
|
Description: A cloning plasmid for the DISP1 gene. |
DISP1 cloning plasmid |
CSB-CL839320HU1-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2754
- Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata
- Show more
|
Description: A cloning plasmid for the DISP1 gene. |
Dispatched Homolog 1 (DISP1) Antibody |
20-abx112105 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dispatched Homolog 1 (DISP1) Antibody |
20-abx102141 |
Abbexa |
-
EUR 467.00
-
EUR 133.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Dispatched Homolog 1 (DISP1) Antibody |
abx432607-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAN612Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 628.00
-
EUR 7258.00
-
EUR 1912.00
-
EUR 842.00
-
EUR 344.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7. |
Mouse DISP1 shRNA Plasmid |
20-abx976776 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DISP1 shRNA Plasmid |
20-abx963739 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DISP1 Rabbit Polyclonal Antibody