DISP1 Rabbit Polyclonal Antibody

DISP1 Polyclonal Antibody
ABP58376-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350 Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

Polyclonal DISP1 Antibody
APR11735G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 . This antibody is tested and proven to work in the following applications:

DISP1 Polyclonal Antibody
ES11302-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DISP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DISP1 Polyclonal Antibody
ES11302-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DISP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DISP1 Rabbit pAb
A14946-100ul	Abclonal	100 ul	EUR 308

DISP1 Rabbit pAb
A14946-200ul	Abclonal	200 ul	EUR 459

DISP1 Rabbit pAb
A14946-20ul	Abclonal	20 ul	EUR 183

DISP1 Rabbit pAb
A14946-50ul	Abclonal	50 ul	EUR 223

DISP1 Polyclonal Conjugated Antibody
C28772	SAB	100ul	EUR 397

DISP1 Antibody
25400-100ul	SAB	100ul	EUR 390

DISP1 antibody
70R-16842	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody
1-CSB-PA006916GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DISP1 antibody
70R-6341	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DISP1 antibody

Polyclonal DISP1 antibody - middle region
APR11736G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal DISPA / DISP1 Antibody (N-Terminus)
APR11737G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications:

anti- DISP1 antibody
FNab02398	FN Test	100µg	EUR 585
Immunogen: dispatched homolog 1(Drosophila) Uniprot ID: Q96F81 Gene ID: 84976 Research Area: Neuroscience, Developmental biology
Description: Antibody raised against DISP1

Anti-DISP1 antibody
PAab02398	Lifescience Market	100 ug	EUR 412

Anti-DISP1 antibody
STJ117145	St John's Laboratory	100 µl	EUR 277
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo.

Anti-DISP1 antibody
STJ192460	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DISP1

DISP1 siRNA
20-abx914188	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DISP1 siRNA
20-abx914189	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse)
4-PAN612Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1)

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC
4-PAN612Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAN612Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3
4-PAN612Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC
4-PAN612Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP
4-PAN612Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE
4-PAN612Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE.

DISP1 Blocking Peptide
33R-3115	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341

DISP1 cloning plasmid
CSB-CL839320HU1-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2754 Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata Show more
Description: A cloning plasmid for the DISP1 gene.

DISP1 cloning plasmid
CSB-CL839320HU2-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1629 Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta Show more
Description: A cloning plasmid for the DISP1 gene.

pCMV-SPORT6-DISP1
PVT13099	Lifescience Market	2 ug	EUR 391

Dispatched Homolog 1 (DISP1) Antibody
20-abx102141	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dispatched Homolog 1 (DISP1) Antibody
20-abx112105	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Antibody
abx432607-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAN612Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DISP1 (Ile1141~Gln1435) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7.

DISP1 ELISA KIT|Human
EF009119	Lifescience Market	96 Tests	EUR 689

Mouse DISP1 shRNA Plasmid
20-abx976776	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DISP1 Rabbit Polyclonal Antibody