셀타젠 Genetic Genotyping

DISP1 Rabbit Polyclonal Antibody

DISP1 Polyclonal Antibody

ABP58376-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

DISP1 Polyclonal Antibody

ABP58376-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of DISP1 from Human, Mouse. This DISP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DISP1 protein at amino acid sequence of 270-350

DISP1 Polyclonal Antibody

28772-100ul 100ul
EUR 252

DISP1 Polyclonal Antibody

28772-50ul 50ul
EUR 187

DISP1 Rabbit pAb

A14946-100ul 100 ul
EUR 308

DISP1 Rabbit pAb

A14946-200ul 200 ul
EUR 459

DISP1 Rabbit pAb

A14946-20ul 20 ul
EUR 183

DISP1 Rabbit pAb

A14946-50ul 50 ul
EUR 223

DISP1 Polyclonal Conjugated Antibody

C28772 100ul
EUR 397

DISP1 antibody

70R-6341 50 ug
EUR 467
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody

25400-100ul 100ul
EUR 390

DISP1 antibody

70R-16842 50 ul
EUR 435
Description: Rabbit polyclonal DISP1 antibody

DISP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DISP1. Recognizes DISP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal DISP1 antibody - middle region

APR11736G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISP1 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal DISPA / DISP1 Antibody (N-Terminus)

APR11737G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DISPA / DISP1 (N-Terminus). This antibody is tested and proven to work in the following applications:

anti- DISP1 antibody

FNab02398 100µg
EUR 585
  • Immunogen: dispatched homolog 1(Drosophila)
  • Uniprot ID: Q96F81
  • Gene ID: 84976
  • Research Area: Neuroscience, Developmental biology
Description: Antibody raised against DISP1

Anti-DISP1 antibody

PAab02398 100 ug
EUR 412

Anti-DISP1 antibody

STJ117145 100 µl
EUR 277
Description: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo.

Anti-DISP1 antibody

STJ192460 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DISP1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1)

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Biotin.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with Cy3.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with FITC.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with HRP.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with PE.

DISP1 Blocking Peptide

33R-3115 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISP1 antibody, catalog no. 70R-6341

DISP1 cloning plasmid

CSB-CL839320HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1629
  • Sequence: atggctatgagcaatggaaacaatgattttgtggttctgagcaacagcagcatcgcaaccagtgctgctaacccgagtcccctcaccccctgtgatggagaccatgcagcccagcagctcacacccaaagaagcaacaagaacaaaagtgagtccaaatggatgcctgcaactta
  • Show more
Description: A cloning plasmid for the DISP1 gene.

DISP1 cloning plasmid

CSB-CL839320HU1-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2754
  • Sequence: atgttcgtcaccagttttaccactgctgctgccttttatgctaactatgttagcaacattacagcaatccgatgctttggggtttatgcggggacagctatattggtgaattacgttttgatggtcacatggcttccagcagttgttgtgctgcatgagcggtatcttcttaata
  • Show more
Description: A cloning plasmid for the DISP1 gene.


PVT13099 2 ug
EUR 391

Dispatched Homolog 1 (DISP1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dispatched Homolog 1 (DISP1) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dispatched Homolog 1 (DISP1) Antibody

abx432607-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dispatched Homolog 1 (DISP1) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DISP1 (Ile1141~Gln1435)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dispatched Homolog 1 (DISP1). This antibody is labeled with APC-Cy7.

Mouse DISP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DISP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DISP1 Rabbit Polyclonal Antibody