
셀타젠 Genetic Genotyping

DKK2 Rabbit Polyclonal Antibody

DKK2 Rabbit Polyclonal Antibody

DKK2 Polyclonal Antibody

A56671 100 µg
EUR 570.55
Description: fast delivery possible

DKK2 Polyclonal Antibody

ES11076-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK2 Polyclonal Antibody

ES11076-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK2 Rabbit pAb

A14874-100ul 100 ul
EUR 308

DKK2 Rabbit pAb

A14874-200ul 200 ul
EUR 459

DKK2 Rabbit pAb

A14874-20ul 20 ul
EUR 183

DKK2 Rabbit pAb

A14874-50ul 50 ul
EUR 223

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit

DLR-DKK2-Hu-48T 48T
EUR 498
  • Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit

DLR-DKK2-Hu-96T 96T
EUR 647
  • Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit

RDR-DKK2-Hu-48Tests 48 Tests
EUR 522

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit

RDR-DKK2-Hu-96Tests 96 Tests
EUR 724

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit

RD-DKK2-Hu-48Tests 48 Tests
EUR 500

Human Dickkopf Related Protein 2 (DKK2) ELISA Kit

RD-DKK2-Hu-96Tests 96 Tests
EUR 692

Rabbit DKK2 ELISA Kit

ERTD0170 96Tests
EUR 521

DKK2 antibody

20R-1730 100 ug
EUR 673
Description: Rabbit polyclonal DKK2 antibody

DKK2 antibody

70R-12099 100 ug
EUR 403
Description: Rabbit polyclonal DKK2 antibody

DKK2 antibody

70R-12100 100 ug
EUR 403
Description: Rabbit polyclonal DKK2 antibody

DKK2 Antibody

35714-100ul 100ul
EUR 252

DKK2 Antibody

EUR 316

DKK2 Antibody

EUR 146

DKK2 Antibody

EUR 316

DKK2 Antibody

EUR 146

DKK2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

DKK2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DKK2 Antibody

DF12942 200ul
EUR 304
Description: DKK2 Antibody detects endogenous levels of DKK2.

DKK2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Polyclonal Dkk2 antibody - middle region

APC00094G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk2 - middle region. This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-DKK2 Antibody

APR16264G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK2 . This antibody is tested and proven to work in the following applications:

Polyclonal DKK2 Antibody (N-term)

APR14288G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK2 (N-term). This antibody is tested and proven to work in the following applications:

DKK2 Polyclonal Antibody, HRP Conjugated

A56672 100 µg
EUR 570.55
Description: reagents widely cited

DKK2 Polyclonal Antibody, FITC Conjugated

A56673 100 µg
EUR 570.55
Description: Ask the seller for details

DKK2 Polyclonal Antibody, Biotin Conjugated

A56674 100 µg
EUR 570.55
Description: The best epigenetics products

DKK2 Conjugated Antibody

C35714 100ul
EUR 397

anti- DKK2 antibody

FNab02402 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: dickkopf homolog 2
  • Uniprot ID: Q9UBU2
  • Gene ID: 27123
  • Research Area: Developmental biology
Description: Antibody raised against DKK2

Anti-DKK2 antibody

PAab02402 100 ug
EUR 355

Anti-DKK2 Antibody

PB9551 100ug/vial
EUR 294

Anti-DKK2 antibody

STJ117074 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).

Anti-DKK2 antibody

STJ192234 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DKK2

Anti-DKK2 antibody

STJ70136 100 µg
EUR 359


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DKK2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DKK2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DKK2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human)

  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2)

DKK2 Blocking Peptide

33R-10552 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 20R-1730

DKK2 Blocking Peptide

33R-10919 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 70R-12099

Dkk2 Blocking Peptide

EUR 153

DKK2 Blocking Peptide

DF12942-BP 1mg
EUR 195

DKK2 cloning plasmid

CSB-CL866207HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atggccgcgttgatgcggagcaaggattcgtcctgctgcctgctcctactggccgcggtgctgatggtggagagctcacagatcggcagttcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctggtcaggccgccaatcgatctgcgggcatgtacca
  • Show more
Description: A cloning plasmid for the DKK2 gene.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC

  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Biotinylated

  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Biotin.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Cy3

  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Cy3.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), FITC

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with FITC.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), HRP

  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with HRP.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), PE

  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with PE.

Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK2 (Asp159~Lys258)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC-Cy7.

Dickkopf Related Protein 2 (DKK2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dickkopf Related Protein 2 (DKK2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dickkopf Related Protein 2 (DKK2) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Dickkopf Related Protein 2 (DKK2) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DKK2 protein (His tag)

80R-2444 20 ug
EUR 322
Description: Purified recombinant DKK2 protein (His tag)

Human DKK2 ELISA Kit

EHD0170 96Tests
EUR 521


EGTD0170 96Tests
EUR 521

Bovine DKK2 ELISA Kit

EBD0170 96Tests
EUR 521

Canine DKK2 ELISA Kit

ECD0170 96Tests
EUR 521

Chicken DKK2 ELISA Kit

ECKD0170 96Tests
EUR 521

Anserini DKK2 ELISA Kit

EAD0170 96Tests
EUR 521

Human DKK2 ELISA Kit

ELA-E9039h 96 Tests
EUR 824


EF006472 96 Tests
EUR 689

Mouse DKK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DKK2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DKK2 ELISA Kit

EMD0170 96Tests
EUR 521


ERD0170 96Tests
EUR 521

Sheep DKK2 ELISA Kit

ESD0170 96Tests
EUR 521

Monkey DKK2 ELISA Kit

EMKD0170 96Tests
EUR 521

Porcine DKK2 ELISA Kit

EPD0170 96Tests
EUR 521

DKK2 Recombinant Protein (Human)

RP038533 100 ug Ask for price

DKK2 Recombinant Protein (Rat)

RP198113 100 ug Ask for price

DKK2 Recombinant Protein (Mouse)

RP129131 100 ug Ask for price

Rabbit Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) ELISA Kit

abx362747-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx122683-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx028487-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx028487-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx028488-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx028488-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dickkopf Related Protein 2 (DKK2) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx432609-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf-Related Protein 2 (DKK2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody

abx232402-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Guinea Pig DKK2 ELISA Kit

EGD0170 96Tests
EUR 521

Dkk2 ORF Vector (Rat) (pORF)

ORF066039 1.0 ug DNA
EUR 506

DKK2 ORF Vector (Human) (pORF)

ORF012845 1.0 ug DNA
EUR 354

Dkk2 ORF Vector (Mouse) (pORF)

ORF043045 1.0 ug DNA
EUR 506

DKK2 ELISA Kit (Human) (OKCD07076)

OKCD07076 96 Wells
EUR 936
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL

DKK2 ELISA Kit (Rat) (OKEI00756)

OKEI00756 96 Wells
EUR 767
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094U/mL

DKK2 ELISA Kit (Rat) (OKWB00355)

OKWB00355 96 Wells
EUR 572
Description: Description of target: Gw7_17852;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 U/mL

DKK2 ELISA Kit (Mouse) (OKEH03567)

OKEH03567 96 Wells
EUR 727
Description: Description of target: Antagonizes canonical Wnt signaling by inhibiting LRP5/6 interaction with Wnt and by forming a ternary complex with the transmembrane protein KREMEN that promotes internalization of LRP5/6. DKKs play an important role in vertebrate development, where they locally inhibit Wnt regulated processes such as antero-posterior axial patterning, limb development, somitogenesis and eye formation. In the adult, Dkks are implicated in bone formation and bone disease, cancer and Alzheimer disease.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.94 pg/mL

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human)

  • EUR 247.00
  • EUR 2523.00
  • EUR 628.00
  • EUR 311.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2)

Human Dickkopf-related protein 2 (DKK2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dickkopf-related protein 2(DKK2) expressed in E.coli

DKK2 sgRNA CRISPR Lentivector set (Human)

K0605201 3 x 1.0 ug
EUR 339

Dkk2 sgRNA CRISPR Lentivector set (Rat)

K6747901 3 x 1.0 ug
EUR 339

Dkk2 sgRNA CRISPR Lentivector set (Mouse)

K3904001 3 x 1.0 ug
EUR 339

Recombinant Dickkopf Related Protein 2 (DKK2)

  • EUR 556.96
  • EUR 252.00
  • EUR 1813.60
  • EUR 671.20
  • EUR 1242.40
  • EUR 436.00
  • EUR 4384.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBU2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 12.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dickkopf Related Protein 2 expressed in: E.coli

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), APC

  • EUR 346.00
  • EUR 3293.00
  • EUR 917.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC.

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), Biotinylated

  • EUR 312.00
  • EUR 2473.00
  • EUR 730.00
  • EUR 382.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Biotin.

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), Cy3

  • EUR 420.00
  • EUR 4349.00
  • EUR 1181.00
  • EUR 547.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Cy3.

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), FITC

  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with FITC.

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), HRP

  • EUR 317.00
  • EUR 2870.00
  • EUR 811.00
  • EUR 399.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with HRP.

Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), PE

  • EUR 297.00
  • EUR 2654.00
  • EUR 753.00
  • EUR 373.00
  • EUR 196.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with PE.

Human Dickkopf Related Protein 2 (DKK2) Protein

  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

DKK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0605202 1.0 ug DNA
EUR 154

DKK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0605203 1.0 ug DNA
EUR 154

DKK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0605204 1.0 ug DNA
EUR 154

Dkk2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6747902 1.0 ug DNA
EUR 154

Dkk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6747903 1.0 ug DNA
EUR 154

Dkk2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6747904 1.0 ug DNA
EUR 154

Dkk2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3904002 1.0 ug DNA
EUR 154

Dkk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3904003 1.0 ug DNA
EUR 154

Dkk2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3904004 1.0 ug DNA
EUR 154

DKK2 Protein Vector (Mouse) (pPB-C-His)

PV172178 500 ng
EUR 603

DKK2 Protein Vector (Mouse) (pPB-N-His)

PV172179 500 ng
EUR 603

DKK2 Protein Vector (Mouse) (pPM-C-HA)

PV172180 500 ng
EUR 603

DKK2 Protein Vector (Mouse) (pPM-C-His)

PV172181 500 ng
EUR 603

DKK2 Protein Vector (Rat) (pPB-C-His)

PV264154 500 ng
EUR 603

DKK2 Protein Vector (Rat) (pPB-N-His)

PV264155 500 ng
EUR 603

DKK2 Protein Vector (Rat) (pPM-C-HA)

PV264156 500 ng
EUR 603

DKK2 Protein Vector (Rat) (pPM-C-His)

PV264157 500 ng
EUR 603

DKK2 Protein Vector (Human) (pPB-C-His)

PV051377 500 ng
EUR 481

DKK2 Protein Vector (Human) (pPB-N-His)

PV051378 500 ng
EUR 481

DKK2 Protein Vector (Human) (pPM-C-HA)

PV051379 500 ng
EUR 481

DKK2 Protein Vector (Human) (pPM-C-His)

PV051380 500 ng
EUR 481

Dkk2 3'UTR GFP Stable Cell Line

TU155170 1.0 ml Ask for price

Dkk2 3'UTR Luciferase Stable Cell Line

TU105170 1.0 ml Ask for price

Dkk2 3'UTR Luciferase Stable Cell Line

TU203434 1.0 ml Ask for price

Dkk2 3'UTR GFP Stable Cell Line

TU253434 1.0 ml Ask for price

DKK2 3'UTR GFP Stable Cell Line

TU056042 1.0 ml
EUR 1521

DKK2 3'UTR Luciferase Stable Cell Line

TU006042 1.0 ml
EUR 1521

DKK2 ELISA Kit (Human) : 96 Wells (OKEH01899)

OKEH01899 96 Wells
EUR 727
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

DKK2 Rabbit Polyclonal Antibody