DKK2 Rabbit Polyclonal Antibody
 DKK2 Polyclonal Antibody |
|
A56671 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
DKK2 Polyclonal Antibody |
|
ES11076-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DKK2 Polyclonal Antibody |
|
ES11076-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DKK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 DKK2 Rabbit pAb |
|
A14874-100ul |
Abclonal |
100 ul |
EUR 308 |
DKK2 Rabbit pAb |
|
A14874-200ul |
Abclonal |
200 ul |
EUR 459 |
DKK2 Rabbit pAb |
|
A14874-20ul |
Abclonal |
20 ul |
EUR 183 |
DKK2 Rabbit pAb |
|
A14874-50ul |
Abclonal |
50 ul |
EUR 223 |
 ELISA Kit) Human Dickkopf Related Protein 2 (DKK2) ELISA Kit |
|
DLR-DKK2-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit |
|
DLR-DKK2-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Dickkopf Related Protein 2 (DKK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 2 (DKK2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit |
|
RDR-DKK2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit |
|
RDR-DKK2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit |
|
RD-DKK2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Dickkopf Related Protein 2 (DKK2) ELISA Kit |
|
RD-DKK2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
 Rabbit DKK2 ELISA Kit |
|
ERTD0170 |
Abclonal |
96Tests |
EUR 521 |
 DKK2 antibody |
|
20R-1730 |
Fitzgerald |
100 ug |
EUR 673 |
|
Description: Rabbit polyclonal DKK2 antibody |
DKK2 antibody |
|
70R-12099 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal DKK2 antibody |
DKK2 antibody |
|
70R-12100 |
Fitzgerald |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal DKK2 antibody |
 DKK2 Antibody |
|
35714-100ul |
SAB |
100ul |
EUR 252 |
DKK2 Antibody |
|
1-CSB-PA08279A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500 |
DKK2 Antibody |
|
1-CSB-PA694579 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
DKK2 Antibody |
|
DF12942 |
Affbiotech |
200ul |
EUR 304 |
|
Description: DKK2 Antibody detects endogenous levels of DKK2. |
DKK2 Antibody |
|
1-CSB-PA284301 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
 Polyclonal Dkk2 antibody - middle region |
|
APC00094G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk2 - middle region. This antibody is tested and proven to work in the following applications: |
 Polyclonal Goat Anti-DKK2 Antibody |
|
APR16264G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK2 . This antibody is tested and proven to work in the following applications: |
) Polyclonal DKK2 Antibody (N-term) |
|
APR14288G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK2 (N-term). This antibody is tested and proven to work in the following applications: |
 DKK2 Polyclonal Antibody, HRP Conjugated |
|
A56672 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 DKK2 Polyclonal Antibody, FITC Conjugated |
|
A56673 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 DKK2 Polyclonal Antibody, Biotin Conjugated |
|
A56674 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 DKK2 Conjugated Antibody |
|
C35714 |
SAB |
100ul |
EUR 397 |
 anti- DKK2 antibody |
|
FNab02402 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: dickkopf homolog 2
- Uniprot ID: Q9UBU2
- Gene ID: 27123
- Research Area: Developmental biology
|
|
Description: Antibody raised against DKK2 |
 Anti-DKK2 Antibody |
|
PB9551 |
BosterBio |
100ug/vial |
EUR 294 |
 Anti-DKK2 antibody |
|
STJ117074 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6). |
Anti-DKK2 antibody |
|
STJ192234 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DKK2 |
 DKK2 siRNA |
|
20-abx914198 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DKK2 siRNA |
|
20-abx914199 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 DKK2 Antibody, HRP conjugated |
|
1-CSB-PA08279B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DKK2 Antibody, FITC conjugated |
|
1-CSB-PA08279C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DKK2 Antibody, Biotin conjugated |
|
1-CSB-PA08279D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DKK2. Recognizes DKK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Polyclonal Antibody (Human)) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human) |
|
4-PAB033Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2) |
 DKK2 Blocking Peptide |
|
33R-10552 |
Fitzgerald |
50 ug |
EUR 349 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 20R-1730 |
DKK2 Blocking Peptide |
|
33R-10919 |
Fitzgerald |
50 ug |
EUR 191 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK2 antibody, catalog no. 70R-12099 |
 Dkk2 Blocking Peptide |
|
3802BP-50 |
Biovision |
|
EUR 153 |
DKK2 Blocking Peptide |
|
DF12942-BP |
Affbiotech |
1mg |
EUR 195 |
 DKK2 cloning plasmid |
|
CSB-CL866207HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 780
- Sequence: atggccgcgttgatgcggagcaaggattcgtcctgctgcctgctcctactggccgcggtgctgatggtggagagctcacagatcggcagttcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctggtcaggccgccaatcgatctgcgggcatgtacca
- Show more
|
|
Description: A cloning plasmid for the DKK2 gene. |
 Polyclonal Antibody (Human), APC) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC |
|
4-PAB033Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAB033Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), Cy3 |
|
4-PAB033Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), FITC |
|
4-PAB033Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), HRP |
|
4-PAB033Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), PE |
|
4-PAB033Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with PE. |
 Polyclonal Antibody (Human), APC-Cy7) Dickkopf Related Protein 2 (DKK2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAB033Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DKK2 (Asp159~Lys258)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC-Cy7. |
 Antibody) Dickkopf Related Protein 2 (DKK2) Antibody |
|
20-abx212865 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dickkopf Related Protein 2 (DKK2) Antibody |
|
20-abx213438 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dickkopf Related Protein 2 (DKK2) Antibody |
|
20-abx102610 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Dickkopf Related Protein 2 (DKK2) Antibody |
|
20-abx172115 |
Abbexa |
-
EUR 328.00
-
EUR 815.00
-
EUR 425.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Antibody) Dickkopf-Related Protein 2 (DKK2) Antibody |
|
20-abx306432 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) DKK2 protein (His tag) |
|
80R-2444 |
Fitzgerald |
20 ug |
EUR 322 |
|
Description: Purified recombinant DKK2 protein (His tag) |
 Human DKK2 ELISA Kit |
|
EHD0170 |
Abclonal |
96Tests |
EUR 521 |
 Goat DKK2 ELISA Kit |
|
EGTD0170 |
Abclonal |
96Tests |
EUR 521 |
 Bovine DKK2 ELISA Kit |
|
EBD0170 |
Abclonal |
96Tests |
EUR 521 |
 Canine DKK2 ELISA Kit |
|
ECD0170 |
Abclonal |
96Tests |
EUR 521 |
 Chicken DKK2 ELISA Kit |
|
ECKD0170 |
Abclonal |
96Tests |
EUR 521 |
 Anserini DKK2 ELISA Kit |
|
EAD0170 |
Abclonal |
96Tests |
EUR 521 |
 Mouse DKK2 shRNA Plasmid |
|
20-abx974917 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DKK2 shRNA Plasmid |
|
20-abx958977 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse DKK2 ELISA Kit |
|
EMD0170 |
Abclonal |
96Tests |
EUR 521 |
 Rat DKK2 ELISA Kit |
|
ERD0170 |
Abclonal |
96Tests |
EUR 521 |
 Sheep DKK2 ELISA Kit |
|
ESD0170 |
Abclonal |
96Tests |
EUR 521 |
 Monkey DKK2 ELISA Kit |
|
EMKD0170 |
Abclonal |
96Tests |
EUR 521 |
 Porcine DKK2 ELISA Kit |
|
EPD0170 |
Abclonal |
96Tests |
EUR 521 |
) DKK2 Recombinant Protein (Human) |
|
RP038533 |
ABM |
100 ug |
Ask for price |
) DKK2 Recombinant Protein (Rat) |
|
RP198113 |
ABM |
100 ug |
Ask for price |
) DKK2 Recombinant Protein (Mouse) |
|
RP129131 |
ABM |
100 ug |
Ask for price |
 (DKK2) ELISA Kit) Rabbit Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) ELISA Kit |
|
abx362747-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 (DKK2) Antibody) Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx122683-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx028487-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx028487-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx028488-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx028488-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Dickkopf Related Protein 2 (DKK2) Antibody (Biotin) |
|
20-abx272078 |
Abbexa |
-
EUR 439.00
-
EUR 244.00
-
EUR 1261.00
-
EUR 606.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx432609-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 Antibody (HRP)) Dickkopf-Related Protein 2 (DKK2) Antibody (HRP) |
|
20-abx306433 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Dickkopf-Related Protein 2 (DKK2) Antibody (FITC) |
|
20-abx306434 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Dickkopf-Related Protein 2 (DKK2) Antibody (Biotin) |
|
20-abx306435 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dickkopf 2 Homolog (Xenopus Laevis) (DKK2) Antibody |
|
abx232402-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 Guinea Pig DKK2 ELISA Kit |
|
EGD0170 |
Abclonal |
96Tests |
EUR 521 |
 (pORF)) Dkk2 ORF Vector (Rat) (pORF) |
|
ORF066039 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) DKK2 ORF Vector (Human) (pORF) |
|
ORF012845 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Dkk2 ORF Vector (Mouse) (pORF) |
|
ORF043045 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD07076)) DKK2 ELISA Kit (Human) (OKCD07076) |
|
OKCD07076 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
|
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL |
 (OKEI00756)) DKK2 ELISA Kit (Rat) (OKEI00756) |
|
OKEI00756 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
|
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094U/mL |
 (OKWB00355)) DKK2 ELISA Kit (Rat) (OKWB00355) |
|
OKWB00355 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
|
Description: Description of target: Gw7_17852;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 U/mL |
 (OKEH03567)) DKK2 ELISA Kit (Mouse) (OKEH03567) |
|
OKEH03567 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
|
Description: Description of target: Antagonizes canonical Wnt signaling by inhibiting LRP5/6 interaction with Wnt and by forming a ternary complex with the transmembrane protein KREMEN that promotes internalization of LRP5/6. DKKs play an important role in vertebrate development, where they locally inhibit Wnt regulated processes such as antero-posterior axial patterning, limb development, somitogenesis and eye formation. In the adult, Dkks are implicated in bone formation and bone disease, cancer and Alzheimer disease.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.94 pg/mL |
 Monoclonal Antibody (Human)) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human) |
|
4-MAB033Hu22 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2523.00
-
EUR 628.00
-
EUR 311.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2) |
) Human Dickkopf-related protein 2 (DKK2) |
|
1-CSB-EP866207HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Dickkopf-related protein 2(DKK2) expressed in E.coli |
) DKK2 sgRNA CRISPR Lentivector set (Human) |
|
K0605201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dkk2 sgRNA CRISPR Lentivector set (Rat) |
|
K6747901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dkk2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3904001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Recombinant Dickkopf Related Protein 2 (DKK2) |
|
4-RPB033Hu01 |
Cloud-Clone |
-
EUR 556.96
-
EUR 252.00
-
EUR 1813.60
-
EUR 671.20
-
EUR 1242.40
-
EUR 436.00
-
EUR 4384.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9UBU2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 12.9kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Dickkopf Related Protein 2 expressed in: E.coli |
 Monoclonal Antibody (Human), APC) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), APC |
|
4-MAB033Hu22-APC |
Cloud-Clone |
-
EUR 346.00
-
EUR 3293.00
-
EUR 917.00
-
EUR 441.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with APC. |
 Monoclonal Antibody (Human), Biotinylated) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), Biotinylated |
|
4-MAB033Hu22-Biotin |
Cloud-Clone |
-
EUR 312.00
-
EUR 2473.00
-
EUR 730.00
-
EUR 382.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Biotin. |
 Monoclonal Antibody (Human), Cy3) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), Cy3 |
|
4-MAB033Hu22-Cy3 |
Cloud-Clone |
-
EUR 420.00
-
EUR 4349.00
-
EUR 1181.00
-
EUR 547.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with Cy3. |
 Monoclonal Antibody (Human), FITC) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), FITC |
|
4-MAB033Hu22-FITC |
Cloud-Clone |
-
EUR 297.00
-
EUR 2654.00
-
EUR 753.00
-
EUR 373.00
-
EUR 196.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with FITC. |
 Monoclonal Antibody (Human), HRP) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), HRP |
|
4-MAB033Hu22-HRP |
Cloud-Clone |
-
EUR 317.00
-
EUR 2870.00
-
EUR 811.00
-
EUR 399.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with HRP. |
 Monoclonal Antibody (Human), PE) Dickkopf Related Protein 2 (DKK2) Monoclonal Antibody (Human), PE |
|
4-MAB033Hu22-PE |
Cloud-Clone |
-
EUR 297.00
-
EUR 2654.00
-
EUR 753.00
-
EUR 373.00
-
EUR 196.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Mouse monoclonal antibody against Human Dickkopf Related Protein 2 (DKK2). This antibody is labeled with PE. |
 Protein) Human Dickkopf Related Protein 2 (DKK2) Protein |
|
20-abx066332 |
Abbexa |
-
EUR 773.00
-
EUR 300.00
-
EUR 2444.00
-
EUR 926.00
-
EUR 551.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) DKK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0605202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DKK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0605203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DKK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0605204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dkk2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6747902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dkk2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6747903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dkk2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6747904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dkk2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3904002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dkk2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3904003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dkk2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3904004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DKK2 Protein Vector (Mouse) (pPB-C-His) |
|
PV172178 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DKK2 Protein Vector (Mouse) (pPB-N-His) |
|
PV172179 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DKK2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV172180 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DKK2 Protein Vector (Mouse) (pPM-C-His) |
|
PV172181 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DKK2 Protein Vector (Rat) (pPB-C-His) |
|
PV264154 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DKK2 Protein Vector (Rat) (pPB-N-His) |
|
PV264155 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DKK2 Protein Vector (Rat) (pPM-C-HA) |
|
PV264156 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DKK2 Protein Vector (Rat) (pPM-C-His) |
|
PV264157 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DKK2 Protein Vector (Human) (pPB-C-His) |
|
PV051377 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) DKK2 Protein Vector (Human) (pPB-N-His) |
|
PV051378 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) DKK2 Protein Vector (Human) (pPM-C-HA) |
|
PV051379 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) DKK2 Protein Vector (Human) (pPM-C-His) |
|
PV051380 |
ABM |
500 ng |
EUR 481 |
 Dkk2 3'UTR GFP Stable Cell Line |
|
TU155170 |
ABM |
1.0 ml |
Ask for price |
 Dkk2 3'UTR Luciferase Stable Cell Line |
|
TU105170 |
ABM |
1.0 ml |
Ask for price |
Dkk2 3'UTR Luciferase Stable Cell Line |
|
TU203434 |
ABM |
1.0 ml |
Ask for price |
Dkk2 3'UTR GFP Stable Cell Line |
|
TU253434 |
ABM |
1.0 ml |
Ask for price |
 DKK2 3'UTR GFP Stable Cell Line |
|
TU056042 |
ABM |
1.0 ml |
EUR 1521 |
 DKK2 3'UTR Luciferase Stable Cell Line |
|
TU006042 |
ABM |
1.0 ml |
EUR 1521 |
 : 96 Wells (OKEH01899)) DKK2 ELISA Kit (Human) : 96 Wells (OKEH01899) |
|
OKEH01899 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
|
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. It can act as either an agonist or antagonist of Wnt/beta-catenin signaling, depending on the cellular context and the presence of the co-factor kremen 2. Activity of this protein is also modulated by binding to the Wnt co-receptor LDL-receptor related protein 6 (LRP6).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
DKK2 Rabbit Polyclonal Antibody
