DKK4 Rabbit Polyclonal Antibody

DKK4 Polyclonal Antibody
ABP58378-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230 Applications tips:
Description: A polyclonal antibody for detection of DKK4 from Human, Mouse. This DKK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230

DKK4 Polyclonal Antibody
ABP58378-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230 Applications tips:
Description: A polyclonal antibody for detection of DKK4 from Human, Mouse. This DKK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230

DKK4 Polyclonal Antibody
ES11247-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against DKK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK4 Polyclonal Antibody
ES11247-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DKK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK4 Rabbit pAb
A7797-100ul	Abclonal	100 ul	EUR 308

DKK4 Rabbit pAb
A7797-200ul	Abclonal	200 ul	EUR 459

DKK4 Rabbit pAb
A7797-20ul	Abclonal	20 ul	EUR 183

DKK4 Rabbit pAb
A7797-50ul	Abclonal	50 ul	EUR 223

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Hu-48T	DL Develop	48T	EUR 554
Should the Human Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Hu-96T	DL Develop	96T	EUR 725
Should the Human Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Mu-48T	DL Develop	48T	EUR 566
Should the Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Mu-96T	DL Develop	96T	EUR 741
Should the Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Mu-48Tests	Reddot Biotech	48 Tests	EUR 603

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Mu-96Tests	Reddot Biotech	96 Tests	EUR 840

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Mu-48Tests	Reddot Biotech	48 Tests	EUR 577

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Mu-96Tests	Reddot Biotech	96 Tests	EUR 802

DKK4 antibody
20R-1754	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal DKK4 antibody

DKK4 antibody
70R-12171	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal DKK4 antibody

DKK4 Antibody
35713-100ul	SAB	100ul	EUR 252

DKK4 Antibody
3894-100	Biovision		EUR 316

DKK4 Antibody
3894-30T	Biovision		EUR 146

DKK4 Antibody
1-CSB-PA883367ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DKK4 Antibody
1-CSB-PA883367ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

DKK4 Antibody
1-CSB-PA153505	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal DKK4 Antibody (C-term)
APR15747G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-DKK4 Antibody
APR16265G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK4 . This antibody is tested and proven to work in the following applications:

Polyclonal DKK4 Antibody (N-term)
APR14289G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK4 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Dkk4 antibody - C-terminal region
APC00105G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk4 - C-terminal region. This antibody is tested and proven to work in the following applications:

DKK4 Conjugated Antibody
C35713	SAB	100ul	EUR 397

Anti-DKK4 antibody
STJ110107	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2.

Anti-DKK4 antibody
STJ192405	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DKK4

Anti-DKK4 antibody
STJ70138	St John's Laboratory	100 µg	EUR 359

DKK4 siRNA
20-abx914202	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DKK4 siRNA
20-abx914203	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DKK4
YF-PA18381	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DKK4

anti-DKK4
YF-PA18382	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DKK4

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human)
4-PAQ088Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4)

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse)
4-PAQ088Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4)

DKK4 Blocking Peptide
33R-10566	Fitzgerald	50 ug	EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK4 antibody, catalog no. 20R-1754

DKK4 Blocking Peptide
33R-10983	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK4 antibody, catalog no. 70R-12171

DKK4 Blocking Peptide
3894BP-50	Biovision		EUR 153

DKK4 cloning plasmid
CSB-CL883367HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 675 Sequence: ATGGTGGCGGCCGTCCTGCTGGGGCTGAGCTGGCTCTGCTCTCCCCTGGGAGCTCTGGTCCTGGACTTCAACAACATCAGGAGCTCTGCTGACCTGCATGGGGCCCGGAAGGGCTCACAGTGCCTGTCTGACACGGACTGCAATACCAGAAAGTTCTGCCTCCAGCCCCGCGATGA Show more
Description: A cloning plasmid for the DKK4 gene.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), APC
4-PAQ088Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), Biotinylated
4-PAQ088Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Biotin.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), Cy3
4-PAQ088Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Cy3.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), FITC
4-PAQ088Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with FITC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), HRP
4-PAQ088Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with HRP.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), PE
4-PAQ088Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with PE.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), APC
4-PAQ088Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), Biotinylated
4-PAQ088Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Biotin.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), Cy3
4-PAQ088Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Cy3.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), FITC
4-PAQ088Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with FITC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), HRP
4-PAQ088Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with HRP.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), PE
4-PAQ088Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with PE.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx176166	Abbexa	EUR 1344.00 EUR 634.00	1 mg 200 ug
Please enquire.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx210812	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx102611	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx129067	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx172117	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), APC-Cy7
4-PAQ088Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Gln107~His212) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC-Cy7.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAQ088Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKK4 (Lys37~Glu141) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC-Cy7.

Human DKK4 ELISA Kit
ELA-E5890h	Lifescience Market	96 Tests	EUR 824

DKK4 ELISA KIT|Human
EF000440	Lifescience Market	96 Tests	EUR 689

Human DKK4 shRNA Plasmid
20-abx958975	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DKK4 shRNA Plasmid
20-abx982107	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DKK4 Recombinant Protein (Human)
RP038536	ABM	100 ug	Ask for price

DKK4 Recombinant Protein (Rat)
RP198119	ABM	100 ug	Ask for price

DKK4 Recombinant Protein (Mouse)
RP129137	ABM	100 ug	Ask for price

Rabbit Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) ELISA Kit
abx363554-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx026362-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx026362-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx005655	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx028491-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx028491-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dickkopf Related Protein 4 (DKK4) Antibody (FITC)
20-abx271154	Abbexa	EUR 523.00 EUR 258.00 EUR 1581.00 EUR 732.00 EUR 411.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Dickkopf Related Protein 4 (DKK4) Antibody (Biotin)
20-abx271420	Abbexa	EUR 495.00 EUR 258.00 EUR 1469.00 EUR 690.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx320423	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx321606	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx432610-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx225146	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Mouse DKK4
EK5754	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse DKK4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse DKK4 PicoKine ELISA Kit
EK1578	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse DKK4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Dkk4 ORF Vector (Rat) (pORF)
ORF066041	ABM	1.0 ug DNA	EUR 506

DKK4 ORF Vector (Human) (pORF)
ORF012846	ABM	1.0 ug DNA	EUR 354

Dkk4 ORF Vector (Mouse) (pORF)
ORF043047	ABM	1.0 ug DNA	EUR 506

DKK4 sgRNA CRISPR Lentivector set (Human)
K0605401	ABM	3 x 1.0 ug	EUR 339

Dkk4 sgRNA CRISPR Lentivector set (Rat)
K6707001	ABM	3 x 1.0 ug	EUR 339

Dkk4 sgRNA CRISPR Lentivector set (Mouse)
K4288901	ABM	3 x 1.0 ug	EUR 339

Recombinant Dickkopf Related Protein 4 (DKK4)
4-RPQ088Hu01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UBT3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Dickkopf Related Protein 4 expressed in: E.coli

Recombinant Dickkopf Related Protein 4 (DKK4)
4-RPQ088Mu01	Cloud-Clone	EUR 553.38 EUR 251.00 EUR 1800.16 EUR 666.72 EUR 1233.44 EUR 433.00 EUR 4350.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8VEJ3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 43.5kDa Isoelectric Point: 6.5
Description: Recombinant Mouse Dickkopf Related Protein 4 expressed in: E.coli

Human Dickkopf Related Protein 4 (DKK4) Protein
20-abx167862	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Dickkopf Related Protein 4 (DKK4) Protein
20-abx066333	Abbexa	EUR 773.00 EUR 300.00 EUR 2416.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

DKK4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0605402	ABM	1.0 ug DNA	EUR 154

DKK4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0605403	ABM	1.0 ug DNA	EUR 154

DKK4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0605404	ABM	1.0 ug DNA	EUR 154

Dkk4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6707002	ABM	1.0 ug DNA	EUR 154

Dkk4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6707003	ABM	1.0 ug DNA	EUR 154

Dkk4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6707004	ABM	1.0 ug DNA	EUR 154

Dkk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4288902	ABM	1.0 ug DNA	EUR 154

Dkk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4288903	ABM	1.0 ug DNA	EUR 154

Dkk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4288904	ABM	1.0 ug DNA	EUR 154

DKK4 Protein Vector (Mouse) (pPB-C-His)
PV172186	ABM	500 ng	EUR 603

DKK4 Protein Vector (Mouse) (pPB-N-His)
PV172187	ABM	500 ng	EUR 603

DKK4 Protein Vector (Mouse) (pPM-C-HA)
PV172188	ABM	500 ng	EUR 603

DKK4 Protein Vector (Mouse) (pPM-C-His)
PV172189	ABM	500 ng	EUR 603

DKK4 Protein Vector (Rat) (pPB-C-His)
PV264162	ABM	500 ng	EUR 603

DKK4 Protein Vector (Rat) (pPB-N-His)
PV264163	ABM	500 ng	EUR 603

DKK4 Protein Vector (Rat) (pPM-C-HA)
PV264164	ABM	500 ng	EUR 603

DKK4 Protein Vector (Rat) (pPM-C-His)
PV264165	ABM	500 ng	EUR 603

DKK4 Rabbit Polyclonal Antibody