DKK4 Rabbit Polyclonal Antibody

DKK4 Rabbit Polyclonal Antibody

DKK4 Polyclonal Antibody
ABP58378-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of DKK4 from Human, Mouse. This DKK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230

DKK4 Polyclonal Antibody
ABP58378-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of DKK4 from Human, Mouse. This DKK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKK4 protein at amino acid sequence of 150-230

DKK4 Polyclonal Antibody
ES11247-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DKK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK4 Polyclonal Antibody
ES11247-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DKK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

DKK4 Rabbit pAb
A7797-100ul 100 ul
EUR 308

DKK4 Rabbit pAb
A7797-200ul 200 ul
EUR 459

DKK4 Rabbit pAb
A7797-20ul 20 ul
EUR 183

DKK4 Rabbit pAb
A7797-50ul 50 ul
EUR 223

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Hu-48T 48T
EUR 554
  • Should the Human Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Hu-96T 96T
EUR 725
  • Should the Human Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Mu-48T 48T
EUR 566
  • Should the Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
DLR-DKK4-Mu-96T 96T
EUR 741
  • Should the Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dickkopf Related Protein 4 (DKK4) in samples from serum, plasma or other biological fluids.

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Hu-48Tests 48 Tests
EUR 589

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Hu-96Tests 96 Tests
EUR 820

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Mu-48Tests 48 Tests
EUR 603

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RDR-DKK4-Mu-96Tests 96 Tests
EUR 840

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Hu-48Tests 48 Tests
EUR 563

Human Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Hu-96Tests 96 Tests
EUR 783

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Mu-48Tests 48 Tests
EUR 577

Mouse Dickkopf Related Protein 4 (DKK4) ELISA Kit
RD-DKK4-Mu-96Tests 96 Tests
EUR 802

DKK4 antibody
20R-1754 100 ug
EUR 673
Description: Rabbit polyclonal DKK4 antibody

DKK4 antibody
70R-12171 100 ug
EUR 403
Description: Rabbit polyclonal DKK4 antibody

DKK4 Antibody
35713-100ul 100ul
EUR 252

DKK4 Antibody
3894-100
EUR 316

DKK4 Antibody
3894-30T
EUR 146

DKK4 Antibody
1-CSB-PA883367ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DKK4 Antibody
1-CSB-PA883367ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

DKK4 Antibody
1-CSB-PA153505
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DKK4. Recognizes DKK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Polyclonal DKK4 Antibody (C-term)
APR15747G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK4 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-DKK4 Antibody
APR16265G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DKK4 . This antibody is tested and proven to work in the following applications:

Polyclonal DKK4 Antibody (N-term)
APR14289G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKK4 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Dkk4 antibody - C-terminal region
APC00105G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dkk4 - C-terminal region. This antibody is tested and proven to work in the following applications:

DKK4 Conjugated Antibody
C35713 100ul
EUR 397

Anti-DKK4 antibody
STJ110107 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2.

Anti-DKK4 antibody
STJ192405 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DKK4

Anti-DKK4 antibody
STJ70138 100 µg
EUR 359

DKK4 siRNA
20-abx914202
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DKK4 siRNA
20-abx914203
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DKK4
YF-PA18381 50 ug
EUR 363
Description: Mouse polyclonal to DKK4

anti-DKK4
YF-PA18382 100 ug
EUR 403
Description: Rabbit polyclonal to DKK4

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human)
4-PAQ088Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4)

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse)
4-PAQ088Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4)

DKK4 Blocking Peptide
33R-10566 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK4 antibody, catalog no. 20R-1754

DKK4 Blocking Peptide
33R-10983 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKK4 antibody, catalog no. 70R-12171

DKK4 Blocking Peptide
3894BP-50
EUR 153

DKK4 cloning plasmid
CSB-CL883367HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: ATGGTGGCGGCCGTCCTGCTGGGGCTGAGCTGGCTCTGCTCTCCCCTGGGAGCTCTGGTCCTGGACTTCAACAACATCAGGAGCTCTGCTGACCTGCATGGGGCCCGGAAGGGCTCACAGTGCCTGTCTGACACGGACTGCAATACCAGAAAGTTCTGCCTCCAGCCCCGCGATGA
  • Show more
Description: A cloning plasmid for the DKK4 gene.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), APC
4-PAQ088Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), Biotinylated
4-PAQ088Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Biotin.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), Cy3
4-PAQ088Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Cy3.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), FITC
4-PAQ088Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with FITC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), HRP
4-PAQ088Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with HRP.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), PE
4-PAQ088Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with PE.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), APC
4-PAQ088Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), Biotinylated
4-PAQ088Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Biotin.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), Cy3
4-PAQ088Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with Cy3.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), FITC
4-PAQ088Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with FITC.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), HRP
4-PAQ088Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with HRP.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), PE
4-PAQ088Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with PE.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx176166
  • EUR 1344.00
  • EUR 634.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx210812
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx102611
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx129067
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dickkopf Related Protein 4 (DKK4) Antibody
20-abx172117
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Human), APC-Cy7
4-PAQ088Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Gln107~His212)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC-Cy7.

Dickkopf Related Protein 4 (DKK4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAQ088Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKK4 (Lys37~Glu141)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dickkopf Related Protein 4 (DKK4). This antibody is labeled with APC-Cy7.

Human DKK4 ELISA Kit
ELA-E5890h 96 Tests
EUR 824

DKK4 ELISA KIT|Human
EF000440 96 Tests
EUR 689

Human DKK4 shRNA Plasmid
20-abx958975
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DKK4 shRNA Plasmid
20-abx982107
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DKK4 Recombinant Protein (Human)
RP038536 100 ug Ask for price

DKK4 Recombinant Protein (Rat)
RP198119 100 ug Ask for price

DKK4 Recombinant Protein (Mouse)
RP129137 100 ug Ask for price

Rabbit Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) ELISA Kit
abx363554-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx026362-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx026362-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx005655
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx028491-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx028491-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dickkopf Related Protein 4 (DKK4) Antibody (FITC)
20-abx271154
  • EUR 523.00
  • EUR 258.00
  • EUR 1581.00
  • EUR 732.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dickkopf Related Protein 4 (DKK4) Antibody (Biotin)
20-abx271420
  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx320423
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx321606
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
abx432610-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Dickkopf 4 Homolog (Xenopus Laevis) (DKK4) Antibody
20-abx225146
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Mouse DKK4
EK5754 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse DKK4 in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse DKK4 PicoKine ELISA Kit
EK1578 96 wells
EUR 425
Description: For quantitative detection of mouse DKK4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Dkk4 ORF Vector (Rat) (pORF)
ORF066041 1.0 ug DNA
EUR 506

DKK4 ORF Vector (Human) (pORF)
ORF012846 1.0 ug DNA
EUR 354

Dkk4 ORF Vector (Mouse) (pORF)
ORF043047 1.0 ug DNA
EUR 506

DKK4 ELISA Kit (Mouse) (OKCD00636)
OKCD00636 96 Wells
EUR 936
Description: Description of target: Antagonizes canonical Wnt signaling by inhibiting LRP5/6 interaction with Wnt and by forming a ternary complex with the transmembrane protein KREMEN that promotes internalization of LRP5/6. DKKs play an important role in vertebrate development, where they locally inhibit Wnt regulated processes such as antero-posterior axial patterning, limb development, somitogenesis and eye formation. In the adult, Dkks are implicated in bone formation and bone disease, cancer and Alzheimer disease (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.051 ng/mL

DKK4 ELISA Kit (Human) (OKBB00835)
OKBB00835 96 Wells
EUR 544
Description: Description of target: DKK4 is a membersof the Dickkopf family which are negative regulators of the growth-promoting Wnt / beta-catenin signaling pathway. By FISH, the DKK4 gene was mapped to chromosome 8p11.2-p11.1. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. The expression of DKK4 was significantly reduced in hepatocellular carcinomas (HCCs), particularly in HCCs that showed cytoplasmic beta- catenin accumulation. DKK4 expression was also reduced in HCC cell lines. Ectopic expression of DKK4 in 2 HCC cell lines reduced beta-catenin and cyclin D1 protein levels and attenuated beta-catenin activity in reporter gene assays.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Dkk4 ELISA Kit (Mouse) (OKBB01103)
OKBB01103 96 Wells
EUR 505
Description: Description of target: DKK4 is a membersof the Dickkopf family which are negative regulators of the growth-promoting Wnt / beta-catenin signaling pathway. By FISH, the DKK4 gene was mapped to chromosome 8p11.2-p11.1. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2. The expression of DKK4 was significantly reduced in hepatocellular carcinomas (HCCs), particularly in HCCs that showed cytoplasmic beta- catenin accumulation. DKK4 expression was also reduced in HCC cell lines. Ectopic expression of DKK4 in 2 HCC cell lines reduced beta-catenin and cyclin D1 protein levels and attenuated beta-catenin activity in reporter gene assays.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

DKK4 ELISA Kit (Human) (OKCD09444)
OKCD09444 96 Wells
EUR 909
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.067ng/mL

DKK4 ELISA Kit (Human) (OKEH01777)
OKEH01777 96 Wells
EUR 596
Description: Description of target: This gene encodes a protein that is a member of the dickkopf family. The secreted protein contains two cysteine rich regions and is involved in embryonic development through its interactions with the Wnt signaling pathway. Activity of this protein is modulated by binding to the Wnt co-receptor and the co-factor kremen 2.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

DKK4 sgRNA CRISPR Lentivector set (Human)
K0605401 3 x 1.0 ug
EUR 339

Dkk4 sgRNA CRISPR Lentivector set (Rat)
K6707001 3 x 1.0 ug
EUR 339

Dkk4 sgRNA CRISPR Lentivector set (Mouse)
K4288901 3 x 1.0 ug
EUR 339

Recombinant Dickkopf Related Protein 4 (DKK4)
4-RPQ088Hu01
  • EUR 521.12
  • EUR 242.00
  • EUR 1679.20
  • EUR 626.40
  • EUR 1152.80
  • EUR 412.00
  • EUR 4048.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBT3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dickkopf Related Protein 4 expressed in: E.coli

Recombinant Dickkopf Related Protein 4 (DKK4)
4-RPQ088Mu01
  • EUR 553.38
  • EUR 251.00
  • EUR 1800.16
  • EUR 666.72
  • EUR 1233.44
  • EUR 433.00
  • EUR 4350.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8VEJ3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.5kDa
  • Isoelectric Point: 6.5
Description: Recombinant Mouse Dickkopf Related Protein 4 expressed in: E.coli

Human Dickkopf Related Protein 4 (DKK4) Protein
20-abx167862
  • EUR 732.00
  • EUR 286.00
  • EUR 2263.00
  • EUR 871.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Dickkopf Related Protein 4 (DKK4) Protein
20-abx066333
  • EUR 773.00
  • EUR 300.00
  • EUR 2416.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

DKK4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0605402 1.0 ug DNA
EUR 154

DKK4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0605403 1.0 ug DNA
EUR 154

DKK4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0605404 1.0 ug DNA
EUR 154

Dkk4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6707002 1.0 ug DNA
EUR 154

Dkk4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6707003 1.0 ug DNA
EUR 154

Dkk4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6707004 1.0 ug DNA
EUR 154

Dkk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4288902 1.0 ug DNA
EUR 154

Dkk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4288903 1.0 ug DNA
EUR 154

Dkk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4288904 1.0 ug DNA
EUR 154

DKK4 Protein Vector (Mouse) (pPB-C-His)
PV172186 500 ng
EUR 603

DKK4 Protein Vector (Mouse) (pPB-N-His)
PV172187 500 ng
EUR 603

DKK4 Protein Vector (Mouse) (pPM-C-HA)
PV172188 500 ng
EUR 603

DKK4 Rabbit Polyclonal Antibody