DKKL1 Rabbit Polyclonal Antibody

DKKL1 Rabbit Polyclonal Antibody

DKKL1 Polyclonal Antibody
ABP58379-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human DKKL1 protein at amino acid sequence of 50-130 Applications tips:
Description: A polyclonal antibody for detection of DKKL1 from Human, Mouse. This DKKL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKKL1 protein at amino acid sequence of 50-130

DKKL1 Polyclonal Antibody
A68134	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

DKKL1 antibody
70R-7515	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DKKL1 antibody

DKKL1 Antibody
46552-100ul	SAB	100ul	EUR 252

DKKL1 Antibody
47058-100ul	SAB	100ul	EUR 252

DKKL1 Antibody
1-CSB-PA892450LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal DKKL1 Antibody (C-term)
AMM08616G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKKL1 (C-term). This antibody is tested and proven to work in the following applications:

DKKL1 Polyclonal Antibody, HRP Conjugated
A68135	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

DKKL1 Polyclonal Antibody, FITC Conjugated
A68136	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

DKKL1 Polyclonal Antibody, Biotin Conjugated
A68137	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

DKKL1 Conjugated Antibody
C46552	SAB	100ul	EUR 397

DKKL1 Conjugated Antibody
C47058	SAB	100ul	EUR 397

Anti-DKKL1 antibody
STJ192351	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DKKL1

DKKL1 siRNA
20-abx914204	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DKKL1 siRNA
20-abx914205	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DKKL1
YF-PA18380	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to DKKL1

DKKL1 Antibody, HRP conjugated
1-CSB-PA892450LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DKKL1 Antibody, FITC conjugated
1-CSB-PA892450LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DKKL1 Antibody, Biotin conjugated
1-CSB-PA892450LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DKKL1 Blocking Peptide
33R-1858	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKKL1 antibody, catalog no. 70R-7515

DKKL1 cloning plasmid
CSB-CL892450HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 729 Sequence: atgggagaagcctccccacctgcccccgcaaggcggcatctgctggtcctgctgctgctcctctctaccctggtgatcccctccgctgcagctcctatccatgatgctgacgcccaagagagctccttgggtctcacaggcctccagagcctactccaaggcttcagccgactttt Show more
Description: A cloning plasmid for the DKKL1 gene.

Dickkopf-Like 1 (DKKL1) Antibody
abx028492-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody
abx028492-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody
20-abx312308	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat)
4-PAP091Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1)

Mouse DKKL1 shRNA Plasmid
20-abx974096	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DKKL1 ELISA Kit
ELA-E4999h	Lifescience Market	96 Tests	EUR 824

DKKL1 ELISA KIT|Human
EF006365	Lifescience Market	96 Tests	EUR 689

Human DKKL1 shRNA Plasmid
20-abx958974	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DKKL1 Recombinant Protein (Human)
RP009406	ABM	100 ug	Ask for price

DKKL1 Recombinant Protein (Rat)
RP198122	ABM	100 ug	Ask for price

DKKL1 Recombinant Protein (Mouse)
RP129140	ABM	100 ug	Ask for price

Dickkopf Like Protein 1 (DKKL1) Antibody
20-abx130376	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dickkopf-Like 1 (DKKL1) Antibody (HRP)
20-abx312309	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody (FITC)
20-abx312310	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody (Biotin)
20-abx312311	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC
4-PAP091Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAP091Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Biotin.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAP091Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Cy3.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), FITC
4-PAP091Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with FITC.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), HRP
4-PAP091Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with HRP.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), PE
4-PAP091Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with PE.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAP091Ra01-APC-Cy7	Cloud-Clone	EUR 657.00 EUR 7654.00 EUR 2011.00 EUR 882.00 EUR 355.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DKKL1 (Val21~Leu230) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC-Cy7.

DKKL1 ORF Vector (Human) (pORF)
ORF003136	ABM	1.0 ug DNA	EUR 95

Dkkl1 ORF Vector (Rat) (pORF)
ORF066042	ABM	1.0 ug DNA	EUR 506

Dkkl1 ORF Vector (Mouse) (pORF)
ORF043048	ABM	1.0 ug DNA	EUR 506

DKKL1 ELISA Kit (Human) (OKEH01742)
OKEH01742	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The dickkopf protein family interacts with the Wnt signaling pathway and its members are characterized by two conserved cysteine-rich domains. This gene encodes a secreted protein that has low sequence similarity to the dickkopf-3 protein. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 20 pg/mL

DKKL1 ELISA Kit (Mouse) (OKEH05096)
OKEH05096	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.33 pg/mL

DKKL1 sgRNA CRISPR Lentivector set (Human)
K0605501	ABM	3 x 1.0 ug	EUR 339

Dkkl1 sgRNA CRISPR Lentivector set (Mouse)
K3493901	ABM	3 x 1.0 ug	EUR 339

Dkkl1 sgRNA CRISPR Lentivector set (Rat)
K6588801	ABM	3 x 1.0 ug	EUR 339

Recombinant Dickkopf Like Protein 1 (DKKL1)
4-RPP091Ra01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D4A444 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.0kDa Isoelectric Point: Inquire
Description: Recombinant Rat Dickkopf Like Protein 1 expressed in: E.coli

DKKL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0605502	ABM	1.0 ug DNA	EUR 154

DKKL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0605503	ABM	1.0 ug DNA	EUR 154

DKKL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0605504	ABM	1.0 ug DNA	EUR 154

Rat Dickkopf Like Protein 1 (DKKL1) Protein
20-abx167852	Abbexa	EUR 718.00 EUR 286.00 EUR 2249.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dkkl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3493902	ABM	1.0 ug DNA	EUR 154

Dkkl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3493903	ABM	1.0 ug DNA	EUR 154

Dkkl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3493904	ABM	1.0 ug DNA	EUR 154

DKKL1 Rabbit Polyclonal Antibody