
셀타젠 Genetic Genotyping

DKKL1 Rabbit Polyclonal Antibody

DKKL1 Rabbit Polyclonal Antibody

DKKL1 Polyclonal Antibody

ABP58379-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DKKL1 protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of DKKL1 from Human, Mouse. This DKKL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DKKL1 protein at amino acid sequence of 50-130

DKKL1 Polyclonal Antibody

A68134 100 µg
EUR 570.55
Description: reagents widely cited

DKKL1 antibody

70R-7515 50 ug
EUR 467
Description: Rabbit polyclonal DKKL1 antibody

DKKL1 Antibody

46552-100ul 100ul
EUR 252

DKKL1 Antibody

47058-100ul 100ul
EUR 252

DKKL1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal DKKL1 Antibody (C-term)

AMM08616G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DKKL1 (C-term). This antibody is tested and proven to work in the following applications:

DKKL1 Polyclonal Antibody, HRP Conjugated

A68135 100 µg
EUR 570.55
Description: Ask the seller for details

DKKL1 Polyclonal Antibody, FITC Conjugated

A68136 100 µg
EUR 570.55
Description: The best epigenetics products

DKKL1 Polyclonal Antibody, Biotin Conjugated

A68137 100 µg
EUR 570.55
Description: kits suitable for this type of research

DKKL1 Conjugated Antibody

C46552 100ul
EUR 397

DKKL1 Conjugated Antibody

C47058 100ul
EUR 397

Anti-DKKL1 antibody

STJ192351 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DKKL1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA18380 50 ul
EUR 363
Description: Mouse polyclonal to DKKL1

DKKL1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DKKL1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DKKL1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DKKL1. Recognizes DKKL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DKKL1 Blocking Peptide

33R-1858 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DKKL1 antibody, catalog no. 70R-7515

DKKL1 cloning plasmid

CSB-CL892450HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 729
  • Sequence: atgggagaagcctccccacctgcccccgcaaggcggcatctgctggtcctgctgctgctcctctctaccctggtgatcccctccgctgcagctcctatccatgatgctgacgcccaagagagctccttgggtctcacaggcctccagagcctactccaaggcttcagccgactttt
  • Show more
Description: A cloning plasmid for the DKKL1 gene.

Dickkopf-Like 1 (DKKL1) Antibody

abx028492-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody

abx028492-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat)

  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1)

Mouse DKKL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E4999h 96 Tests
EUR 824


EF006365 96 Tests
EUR 689

Human DKKL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DKKL1 Recombinant Protein (Human)

RP009406 100 ug Ask for price

DKKL1 Recombinant Protein (Rat)

RP198122 100 ug Ask for price

DKKL1 Recombinant Protein (Mouse)

RP129140 100 ug Ask for price

Dickkopf Like Protein 1 (DKKL1) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dickkopf-Like 1 (DKKL1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf-Like 1 (DKKL1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Biotin.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with Cy3.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with FITC.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with HRP.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with PE.

Dickkopf Like Protein 1 (DKKL1) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DKKL1 (Val21~Leu230)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Dickkopf Like Protein 1 (DKKL1). This antibody is labeled with APC-Cy7.

DKKL1 ORF Vector (Human) (pORF)

ORF003136 1.0 ug DNA
EUR 95

Dkkl1 ORF Vector (Rat) (pORF)

ORF066042 1.0 ug DNA
EUR 506

Dkkl1 ORF Vector (Mouse) (pORF)

ORF043048 1.0 ug DNA
EUR 506

DKKL1 ELISA Kit (Human) (OKEH01742)

OKEH01742 96 Wells
EUR 662
Description: Description of target: The dickkopf protein family interacts with the Wnt signaling pathway and its members are characterized by two conserved cysteine-rich domains. This gene encodes a secreted protein that has low sequence similarity to the dickkopf-3 protein. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 20 pg/mL

DKKL1 ELISA Kit (Mouse) (OKEH05096)

OKEH05096 96 Wells
EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.33 pg/mL

DKKL1 sgRNA CRISPR Lentivector set (Human)

K0605501 3 x 1.0 ug
EUR 339

Dkkl1 sgRNA CRISPR Lentivector set (Mouse)

K3493901 3 x 1.0 ug
EUR 339

Dkkl1 sgRNA CRISPR Lentivector set (Rat)

K6588801 3 x 1.0 ug
EUR 339

Recombinant Dickkopf Like Protein 1 (DKKL1)

  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A444
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Dickkopf Like Protein 1 expressed in: E.coli

DKKL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0605502 1.0 ug DNA
EUR 154

DKKL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0605503 1.0 ug DNA
EUR 154

DKKL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0605504 1.0 ug DNA
EUR 154

Rat Dickkopf Like Protein 1 (DKKL1) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dkkl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3493902 1.0 ug DNA
EUR 154

Dkkl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3493903 1.0 ug DNA
EUR 154

Dkkl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3493904 1.0 ug DNA
EUR 154

DKKL1 Rabbit Polyclonal Antibody