CelltaGen
셀타젠 Genetic Genotyping

DPPA4 Rabbit Polyclonal Antibody

DPPA4 Polyclonal Antibody

ABP58414-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DPPA4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DPPA4 from Human, Mouse, Rat. This DPPA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DPPA4 protein

DPPA4 Polyclonal Antibody

A58842 100 µg
EUR 570.55
Description: fast delivery possible

DPPA4 Polyclonal Antibody

ES11028-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DPPA4 Polyclonal Antibody

ES11028-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DPPA4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

DPPA4 Rabbit pAb

A13724-100ul 100 ul
EUR 308

DPPA4 Rabbit pAb

A13724-200ul 200 ul
EUR 459

DPPA4 Rabbit pAb

A13724-20ul 20 ul
EUR 183

DPPA4 Rabbit pAb

A13724-50ul 50 ul
EUR 223

DPPA4 Rabbit pAb

A13725-100ul 100 ul
EUR 308

DPPA4 Rabbit pAb

A13725-200ul 200 ul
EUR 459

DPPA4 Rabbit pAb

A13725-20ul 20 ul
EUR 183

DPPA4 Rabbit pAb

A13725-50ul 50 ul
EUR 223

DPPA4 Rabbit pAb

A9238-100ul 100 ul
EUR 308

DPPA4 Rabbit pAb

A9238-200ul 200 ul
EUR 459

DPPA4 Rabbit pAb

A9238-20ul 20 ul Ask for price

DPPA4 Rabbit pAb

A9238-50ul 50 ul Ask for price

Polyclonal DPPA4 Antibody (Center)

APC00108G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (Center). This antibody is tested and proven to work in the following applications:

DPPA4 antibody

70R-12122 100 ug
EUR 403
Description: Rabbit polyclonal DPPA4 antibody

DPPA4 Antibody

47509-100ul 100ul
EUR 252

DPPA4 Antibody

3826-100
EUR 316

DPPA4 Antibody

3826-30T
EUR 146

DPPA4 Antibody

1-CSB-PA765975EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DPPA4 antibody

70R-3293 50 ug
EUR 467
Description: Rabbit polyclonal DPPA4 antibody raised against the N terminal of DPPA4

Polyclonal DPPA4 Antibody (aa1-50)

APR02983G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (aa1-50). This antibody is tested and proven to work in the following applications:

Polyclonal DPPA4 Antibody (N-term)

AMM06955G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DPPA4 (N-term). This antibody is tested and proven to work in the following applications:

DPPA4 Polyclonal Antibody, Biotin Conjugated

A58843 100 µg
EUR 570.55
Description: reagents widely cited

DPPA4 Polyclonal Antibody, FITC Conjugated

A58844 100 µg
EUR 570.55
Description: Ask the seller for details

DPPA4 Polyclonal Antibody, HRP Conjugated

A58845 100 µg
EUR 570.55
Description: The best epigenetics products

Anti-DPPA4 Antibody

A10283 100 ug
EUR 397
Description: Rabbit Polyclonal DPPA4 Antibody. Validated in WB and tested in Human.

DPPA4 Conjugated Antibody

C47509 100ul
EUR 397

anti- DPPA4 antibody

FNab02525 100µg
EUR 585
  • Immunogen: developmental pluripotency associated 4
  • Uniprot ID: Q7L190
  • Gene ID: 55211
  • Research Area: Stem Cells
Description: Antibody raised against DPPA4

Anti-DPPA4 antibody

PAab02525 100 ug
EUR 412

Anti-DPPA4 antibody

STJ111623 100 µl
EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.

Anti-DPPA4 antibody

STJ115677 100 µl
EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.

Anti-DPPA4 antibody

STJ115678 100 µl
EUR 277
Description: This gene encodes a nuclear factor that is involved in the maintenance of pluripotency in stem cells and essential for embryogenesis. The encoded protein has a scaffold-attachment factor A/B, acinus and PIAS (SAP) domain that binds DNA and is thought to modify chromatin. Mice with a homozygous knockout of the orthologous gene die during late embryonic development or within hours after birth. Knockout embryos are normal in size at embryonic day 18.5 but exhibit skeletal and lung tissue abnormalities. This gene, when mutated, is highly expressed in embryonal carcinomas, pluripotent germ cell tumors, and other cancers and is thought to play an important role in tumor progression. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.

Anti-DPPA4 antibody

STJ192186 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DPPA4

DPPA4 siRNA

20-abx914576
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DPPA4 siRNA

20-abx914577
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-Dppa4

YF-PA19622 50 ul
EUR 363
Description: Mouse polyclonal to Dppa4

anti-Dppa4

YF-PA19623 50 ug
EUR 363
Description: Mouse polyclonal to Dppa4

anti-Dppa4

YF-PA19624 50 ug
EUR 363
Description: Mouse polyclonal to Dppa4

anti-Dppa4

YF-PA19625 100 ug
EUR 403
Description: Rabbit polyclonal to Dppa4

DPPA4 Antibody, HRP conjugated

1-CSB-PA765975EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DPPA4 Antibody, FITC conjugated

1-CSB-PA765975EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DPPA4 Antibody, Biotin conjugated

1-CSB-PA765975ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DPPA4. Recognizes DPPA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DPPA4 Blocking Peptide

33R-10939 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-12122

DPPA4 Blocking Peptide

33R-6210 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPPA4 antibody, catalog no. 70R-3293

DPPA4 Blocking Peptide

3826BP-50
EUR 153

DPPA4 cloning plasmid

CSB-CL765975HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 885
  • Sequence: atggagaaggcaaaaggcaaggagtggacctccacagagaagtcgagggaagaggatcagcaggcttctaatcaaccaaattcaattgctttgccaggaacatcagcaaagagaaccaaagaaaaaatgtctgtcaaaggcagtaaagtgctctgccctaagaaaaaggcagagca
  • Show more
Description: A cloning plasmid for the DPPA4 gene.

DPPA4 protein (His tag)

80R-2904 100 ug
EUR 424
Description: Purified recombinant DPPA4 protein (His tag)

Human DPPA4 ELISA KIT

ELI-09401h 96 Tests
EUR 824

Mouse Dppa4 ELISA KIT

ELI-09402m 96 Tests
EUR 865

DPPA4 ELISA KIT|Human

EF009215 96 Tests
EUR 689

Mouse DPPA4 shRNA Plasmid

20-abx978001
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DPPA4 shRNA Plasmid

20-abx960560
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DPPA4 Recombinant Protein (Human)

RP009781 100 ug Ask for price

DPPA4 Recombinant Protein (Mouse)

RP129977 100 ug Ask for price

DPPA4 Recombinant Protein (Mouse)

RP129980 100 ug Ask for price

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody

abx028023-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody

abx028023-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody

20-abx124682
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody

20-abx301459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody

abx232525-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DPPA4 ORF Vector (Human) (pORF)

ORF003261 1.0 ug DNA
EUR 95

Dppa4 ORF Vector (Mouse) (pORF)

ORF043327 1.0 ug DNA
EUR 506

Dppa4 ORF Vector (Mouse) (pORF)

ORF043328 1.0 ug DNA
EUR 506

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (HRP)

20-abx308169
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (FITC)

20-abx308170
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Developmental Pluripotency-Associated Protein 4 (DPPA4) Antibody (Biotin)

20-abx308171
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DPPA4 sgRNA CRISPR Lentivector set (Human)

K0628801 3 x 1.0 ug
EUR 339

Dppa4 sgRNA CRISPR Lentivector set (Mouse)

K4938401 3 x 1.0 ug
EUR 339

DPPA4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0628802 1.0 ug DNA
EUR 154

DPPA4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0628803 1.0 ug DNA
EUR 154

DPPA4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0628804 1.0 ug DNA
EUR 154

Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4938402 1.0 ug DNA
EUR 154

Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4938403 1.0 ug DNA
EUR 154

Dppa4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4938404 1.0 ug DNA
EUR 154

DPPA4 Protein Vector (Mouse) (pPB-C-His)

PV173306 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPB-N-His)

PV173307 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-HA)

PV173308 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-His)

PV173309 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPB-C-His)

PV173310 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPB-N-His)

PV173311 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-HA)

PV173312 500 ng
EUR 603

DPPA4 Protein Vector (Mouse) (pPM-C-His)

PV173313 500 ng
EUR 603

DPPA4 Protein Vector (Human) (pPB-C-His)

PV013041 500 ng
EUR 329

DPPA4 Protein Vector (Human) (pPB-N-His)

PV013042 500 ng
EUR 329

DPPA4 Protein Vector (Human) (pPM-C-HA)

PV013043 500 ng
EUR 329

DPPA4 Protein Vector (Human) (pPM-C-His)

PV013044 500 ng
EUR 329

Recombinant Human DPPA4 Protein, His, E.coli-1mg

QP11699-1mg 1mg
EUR 3655

Recombinant Human DPPA4 Protein, His, E.coli-20ug

QP11699-20ug 20ug
EUR 201

Recombinant Human DPPA4 Protein, His, E.coli-5ug

QP11699-5ug 5ug
EUR 155

Dppa4 3'UTR GFP Stable Cell Line

TU155370 1.0 ml Ask for price

Dppa4 3'UTR Luciferase Stable Cell Line

TU105370 1.0 ml Ask for price

DPPA4 3'UTR GFP Stable Cell Line

TU056286 1.0 ml
EUR 1521

DPPA4 3'UTR Luciferase Stable Cell Line

TU006286 1.0 ml
EUR 1521

DPPA4 Developmental Pluripotency Associated 4 Human Recombinant Protein

PROTQ7L190 Regular: 20ug
EUR 317
Description: DPPA4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 327 amino acids (1-304) and having a molecular mass of 35.9kDa.;DPPA4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

DPPA4 Rabbit Polyclonal Antibody