ECE1 Rabbit Polyclonal Antibody

ECE1 Rabbit Polyclonal Antibody

ECE1 Polyclonal Antibody
ABP58449-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ECE1 protein Applications tips:
Description: A polyclonal antibody for detection of ECE1 from Human, Mouse, Rat. This ECE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ECE1 protein

ECE1 Polyclonal Antibody
ES11105-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ECE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ECE1 Polyclonal Antibody
ES11105-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ECE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ECE1 Rabbit pAb
A5638-100ul	Abclonal	100 ul	EUR 308

ECE1 Rabbit pAb
A5638-200ul	Abclonal	200 ul	EUR 459

ECE1 Rabbit pAb
A5638-20ul	Abclonal	20 ul	EUR 183

ECE1 Rabbit pAb
A5638-50ul	Abclonal	50 ul	EUR 223

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
DLR-ECE1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelin Converting Enzyme 1 (ECE1) in samples from serum, plasma or other biological fluids.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
DLR-ECE1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelin Converting Enzyme 1 (ECE1) in samples from serum, plasma or other biological fluids.

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
RDR-ECE1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
RDR-ECE1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
RD-ECE1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
RD-ECE1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Polyclonal ECE1 Antibody (Center)
APR07638G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ECE1 (Center). This antibody is tested and proven to work in the following applications:

ECE1 Antibody
32939-100ul	SAB	100ul	EUR 252

ECE1 Antibody
1-CSB-PA105007	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ECE1. Recognizes ECE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

ECE1 Antibody
1-CSB-PA891748	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ECE1. Recognizes ECE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:1000-1:5000

ECE1 Antibody
DF7430	Affbiotech	200ul	EUR 304
Description: ECE1 Antibody detects endogenous levels of total ECE1.

ECE1 Antibody
1-CSB-PA007371ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ECE1. Recognizes ECE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ECE1 Antibody
ABD7430	Lifescience Market	100 ug	EUR 438

Anti-ECE1 Antibody
A02519-1	BosterBio	100ug/vial	EUR 294

ECE1 Conjugated Antibody
C32939	SAB	100ul	EUR 397

Anti-ECE1 antibody
STJ27605	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Anti-ECE1 antibody
STJ192263	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ECE1

Ece1/ Rat Ece1 ELISA Kit
ELI-47593r	Lifescience Market	96 Tests	EUR 886

ECE1 siRNA
20-abx914901	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ECE1 siRNA
20-abx914902	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ECE1
YF-PA11475	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ECE1

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human)
4-PAA483Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1)

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse)
4-PAA483Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1)

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat)
4-PAA483Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1)

ECE1 Blocking Peptide
DF7430-BP	Affbiotech	1mg	EUR 195

ECE1 cloning plasmid
CSB-CL007371HU-10ug	Cusabio	10ug	EUR 758
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2313 Sequence: atgcggggcgtgtggccgcccccggtgtccgccctgctgtcggcgctggggatgtcgacgtacaagcgggccacgctggacgaggaggacctggtggactcgctctccgagggcgacgcataccccaacggcctgcaggtgaacttccacagcccccggagtggccagaggtgct Show more
Description: A cloning plasmid for the ECE1 gene.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), APC
4-PAA483Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), Biotinylated
4-PAA483Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), Cy3
4-PAA483Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), FITC
4-PAA483Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), HRP
4-PAA483Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), PE
4-PAA483Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), APC
4-PAA483Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA483Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), Cy3
4-PAA483Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), FITC
4-PAA483Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), HRP
4-PAA483Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), PE
4-PAA483Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), APC
4-PAA483Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), Biotinylated
4-PAA483Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Biotin.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), Cy3
4-PAA483Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with Cy3.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), FITC
4-PAA483Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with FITC.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), HRP
4-PAA483Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with HRP.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), PE
4-PAA483Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with PE.

Rabbit Endothelin Converting Enzyme 1 (ECE1) ELISA Kit
abx362668-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx004310	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx214580	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx214643	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx103137	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx103138	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx130012	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx145201-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx172239	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx033018-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx033018-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx033019-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx033019-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx033020-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
abx033020-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Antibody
20-abx320177	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Human), APC-Cy7
4-PAA483Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Leu469~Glu721) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA483Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (Ala326~Asn577) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7.

Endothelin Converting Enzyme 1 (ECE1) Polyclonal Antibody (Rat), APC-Cy7
4-PAA483Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ECE1 (His214~Ala448) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelin Converting Enzyme 1 (ECE1). This antibody is labeled with APC-Cy7.

Human ECE1 ELISA Kit
ELA-E9194h	Lifescience Market	96 Tests	EUR 824

ECE1 ELISA KIT|Human
EF006492	Lifescience Market	96 Tests	EUR 689

Mouse ECE1 shRNA Plasmid
20-abx981830	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ECE1 shRNA Plasmid
20-abx951315	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ECE1 Recombinant Protein (Human)
RP038692	ABM	100 ug	Ask for price

ECE1 Recombinant Protein (Rat)
RP198998	ABM	100 ug	Ask for price

ECE1 Recombinant Protein (Mouse)
RP130712	ABM	100 ug	Ask for price

Human CellExp? ECE1, Human Recombinant
P1227-10	Biovision		EUR 251

Human CellExp? ECE1, Human Recombinant
P1227-50	Biovision		EUR 1012

Ece1 ORF Vector (Rat) (pORF)
ORF066334	ABM	1.0 ug DNA	EUR 506

ECE1 ORF Vector (Human) (pORF)
ORF012898	ABM	1.0 ug DNA	EUR 354

Ece1 ORF Vector (Mouse) (pORF)
ORF043572	ABM	1.0 ug DNA	EUR 506

ECE1 ELISA Kit (Human) (OKAN06233)
OKAN06233	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.8 pg/mL

ECE1 ELISA Kit (Mouse) (OKCA02377)
OKCA02377	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Converts big endothelin-1 to endothelin-1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.039 ng/mL

ECE1 ELISA Kit (Human) (OKCD06380)
OKCD06380	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 11.8pg/mL

ECE1 ELISA Kit (Human) (OKEH01929)
OKEH01929	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 20 pg/mL

ECE1 sgRNA CRISPR Lentivector set (Human)
K0651101	ABM	3 x 1.0 ug	EUR 339

Ece1 sgRNA CRISPR Lentivector set (Rat)
K7040501	ABM	3 x 1.0 ug	EUR 339

Ece1 sgRNA CRISPR Lentivector set (Mouse)
K3662701	ABM	3 x 1.0 ug	EUR 339

Recombinant Endothelin Converting Enzyme 1 (ECE1)
4-RPA483Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P42892 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Endothelin Converting Enzyme 1 expressed in: E.coli

Recombinant Endothelin Converting Enzyme 1 (ECE1)
4-RPA483Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q4PZA2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.3kDa Isoelectric Point: 6.2
Description: Recombinant Mouse Endothelin Converting Enzyme 1 expressed in: E.coli

Recombinant Endothelin Converting Enzyme 1 (ECE1)
4-RPA483Ra01	Cloud-Clone	EUR 521.12 EUR 242.00 EUR 1679.20 EUR 626.40 EUR 1152.80 EUR 412.00 EUR 4048.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P42893 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.8kDa Isoelectric Point: 6
Description: Recombinant Rat Endothelin Converting Enzyme 1 expressed in: E.coli

Rat Endothelin Converting Enzyme 1 (ECE1) Protein
20-abx168533	Abbexa	EUR 732.00 EUR 286.00 EUR 2263.00 EUR 871.00 EUR 523.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Endothelin Converting Enzyme 1 (ECE1) Protein
20-abx066416	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Mouse Endothelin Converting Enzyme 1 (ECE1) Protein
20-abx066417	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

ECE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0651102	ABM	1.0 ug DNA	EUR 154

ECE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0651103	ABM	1.0 ug DNA	EUR 154

ECE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0651104	ABM	1.0 ug DNA	EUR 154

ECE1 Rabbit Polyclonal Antibody