EDN2 Rabbit Polyclonal Antibody
 EDN2 Polyclonal Antibody |
|
ES11086-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EDN2 Polyclonal Antibody |
|
ES11086-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against EDN2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ELISA Kit) Human Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Hu-48T |
DL Develop |
48T |
EUR 463 |
- Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Hu-96T |
DL Develop |
96T |
EUR 599 |
- Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids. |
 ELISA Kit) Rat Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Ra-48T |
DL Develop |
48T |
EUR 495 |
- Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Ra-96T |
DL Develop |
96T |
EUR 644 |
- Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 481 |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 665 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 519 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 720 |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 460 |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 636 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 496 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 688 |
 EDN2 antibody |
|
70R-16997 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal EDN2 antibody |
 EDN2 Antibody |
|
35734-100ul |
SAB |
100ul |
EUR 252 |
EDN2 Antibody |
|
1-CSB-PA033256 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
EDN2 Antibody |
|
1-CSB-PA161267 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
EDN2 Antibody |
|
1-CSB-PA168757 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
EDN2 antibody |
|
70R-9137 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal EDN2 antibody |
EDN2 Antibody |
|
1-CSB-PA007401GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
 Polyclonal Antibody (Human)) Endothelin 2 (EDN2) Polyclonal Antibody (Human) |
|
4-PAF415Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2) |
 EDN2 Conjugated Antibody |
|
C35734 |
SAB |
100ul |
EUR 397 |
 Anti-EDN2 antibody |
|
STJ192244 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to EDN2 |
 Polyclonal Antibody (Human), APC) Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC |
|
4-PAF415Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Endothelin 2 (EDN2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAF415Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Endothelin 2 (EDN2) Polyclonal Antibody (Human), Cy3 |
|
4-PAF415Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Endothelin 2 (EDN2) Polyclonal Antibody (Human), FITC |
|
4-PAF415Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Endothelin 2 (EDN2) Polyclonal Antibody (Human), HRP |
|
4-PAF415Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Endothelin 2 (EDN2) Polyclonal Antibody (Human), PE |
|
4-PAF415Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with PE. |
 EDN2 siRNA |
|
20-abx901638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDN2 siRNA |
|
20-abx914960 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDN2 siRNA |
|
20-abx914961 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Endothelin 2 (EDN2) Antibody |
|
abx027651-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
abx027651-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx176270 |
Abbexa |
|
|
|
|
Endothelin 2 (EDN2) Antibody |
|
20-abx210820 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx211230 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx112293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx128276 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx172237 |
Abbexa |
|
|
|
|
Endothelin 2 (EDN2) Antibody |
|
20-abx172238 |
Abbexa |
|
|
|
|
Endothelin 2 (EDN2) Antibody |
|
20-abx339841 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAF415Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC-Cy7. |
 EDN2 Blocking Peptide |
|
33R-6611 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDN2 antibody, catalog no. 70R-9137 |
 EDN2 cloning plasmid |
|
CSB-CL007401HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtg
- Show more
|
|
Description: A cloning plasmid for the EDN2 gene. |
) EDN2 protein (His tag) |
|
80R-2705 |
Fitzgerald |
100 ug |
EUR 322 |
|
Description: Purified recombinant EDN2 protein (His tag) |
 Protein) Endothelin 2 (EDN2) Protein |
|
20-abx260088 |
Abbexa |
-
EUR 328.00
-
EUR 2736.00
-
EUR 787.00
|
|
- Shipped within 5-10 working days.
|
 Rat EDN2 shRNA Plasmid |
|
20-abx984439 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse EDN2 shRNA Plasmid |
|
20-abx970107 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human EDN2 shRNA Plasmid |
|
20-abx951326 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Recombinant Endothelin 2 (EDN2) |
|
4-RPF415Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20800
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.5kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Endothelin 2 expressed in: E.coli |
) EDN2 Recombinant Protein (Human) |
|
RP010177 |
ABM |
100 ug |
Ask for price |
) EDN2 Recombinant Protein (Rat) |
|
RP199061 |
ABM |
100 ug |
Ask for price |
) EDN2 Recombinant Protein (Mouse) |
|
RP130874 |
ABM |
100 ug |
Ask for price |
 Protein) Human Endothelin 2 (EDN2) Protein |
|
20-abx166607 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Protein) Rat Endothelin 2 (EDN2) Protein |
|
20-abx653272 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 (pORF)) Edn2 ORF Vector (Rat) (pORF) |
|
ORF066355 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) EDN2 ORF Vector (Human) (pORF) |
|
ORF003393 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Edn2 ORF Vector (Mouse) (pORF) |
|
ORF043626 |
ABM |
1.0 ug DNA |
EUR 506 |
 EDN2 Human Endothelin-2 protein |
|
PROTP20800-1 |
BosterBio |
Regular: 5mg |
EUR 697 |
|
Description: EDN2 contains 21 amino acids having a molecular mass of 2546.97 Dalton. |
 (OKCD02399)) EDN2 ELISA Kit (Rat) (OKCD02399) |
|
OKCD02399 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive Inhibition ELISA;Sensitivity: < 2.67 pg/mL |
 (OKEH06451)) EDN2 ELISA Kit (Rat) (OKEH06451) |
|
OKEH06451 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Vasoconstrictor. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 42.3 pg/mL |
 (OKEH01507)) EDN2 ELISA Kit (Mouse) (OKEH01507) |
|
OKEH01507 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a potent vasoconstrictive peptide. This gene is abundantly expressed in the gastrointestinal tract, strongly induced in photorecepteror cells in retinal diseases and injury, and produced by microglia and macrophages in the early stages of glaucoma. Mice lacking the encoded protein exhibit severe growth retardation, hypothermia and juvenile lethality.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.044 ng/mL |
 (M01), Clone: 3B4-1C5) Monoclonal EDN2 Antibody (monoclonal) (M01), Clone: 3B4-1C5 |
|
AMM03480G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human EDN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B4-1C5. This antibody is applicable in WB |
Human Endothelin 2 (EDN2) ELISA Kit |
|
20-abx156808 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Endothelin 2 (EDN2) ELISA Kit |
|
20-abx155474 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Mouse Endothelin 2 (EDN2) ELISA Kit |
|
abx255075-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 Human EDN2/ Endothelin-2 ELISA Kit |
|
E0758Hu |
Sunlong |
1 Kit |
EUR 571 |
 Mouse Edn2/ Endothelin-2 ELISA Kit |
|
E1635Mo |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human EDN2(Endothelin-2) ELISA Kit |
|
EH2114 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.781-50 pg/ml
- Uniprot ID: P20800
- Alias: ET-2/Preproendothelin-2(PPET2)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469pg/ml |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
4-CEF415Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
- PPET2
- Preproendothelin-2
|
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 2 (EDN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
4-CEF415Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
- PPET2
- Preproendothelin-2
|
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Endothelin 2 (EDN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 ELISA kit) Mouse Endothelin-2(EDN2) ELISA kit |
|
CSB-EL007401MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Endothelin-2(EDN2) ELISA kit |
|
1-CSB-EL007401MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA Kit) Human Endothelin-2(EDN2)ELISA Kit |
|
CSB-E16518h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Endothelin-2(EDN2)ELISA Kit |
|
1-CSB-E16518h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
abx575853-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Endothelin 2 (EDN2) ELISA Kit |
|
abx576570-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Cow Endothelin 2 (EDN2) ELISA Kit |
|
abx519466-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Dog Endothelin 2 (EDN2) ELISA Kit |
|
abx519467-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 CLIA Kit) Human Endothelin 2 (EDN2) CLIA Kit |
|
20-abx490518 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 CLIA Kit) Rat Endothelin 2 (EDN2) CLIA Kit |
|
20-abx490519 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 ELISA Kit) Mouse Edn2(Endothelin-2) ELISA Kit |
|
EM0727 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P22389
- Alias: Edn2/ET-2/Preproendothelin-2(PPET2)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml |
) EDN2 sgRNA CRISPR Lentivector set (Human) |
|
K0654001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Edn2 sgRNA CRISPR Lentivector set (Rat) |
|
K6886201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Edn2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3710801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ELISA kit for Human EDN2 (Endothelin 2) |
|
ELK5069 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
- Show more
|
|
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Rat EDN2 (Endothelin 2) |
|
ELK6274 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
- Show more
|
|
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 (Target 1)) EDN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0654002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) EDN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0654003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) EDN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0654004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Edn2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6886202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Edn2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6886203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Edn2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6886204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3710802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3710803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3710804 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Human Endothelin-2 (EDN2) |
|
KTE61953-48T |
Abbkine |
48T |
EUR 332 |
- Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Endothelin-2 (EDN2) |
|
KTE61953-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Endothelin-2 (EDN2) |
|
KTE61953-96T |
Abbkine |
96T |
EUR 539 |
- Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (pPB-C-His)) EDN2 Protein Vector (Mouse) (pPB-C-His) |
|
PV174502 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EDN2 Protein Vector (Mouse) (pPB-N-His) |
|
PV174503 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EDN2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV174504 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EDN2 Protein Vector (Mouse) (pPM-C-His) |
|
PV174505 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) EDN2 Protein Vector (Rat) (pPB-C-His) |
|
PV265418 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EDN2 Protein Vector (Rat) (pPB-N-His) |
|
PV265419 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EDN2 Protein Vector (Rat) (pPM-C-HA) |
|
PV265420 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EDN2 Protein Vector (Rat) (pPM-C-His) |
|
PV265421 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) EDN2 Protein Vector (Human) (pPB-C-His) |
|
PV013569 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) EDN2 Protein Vector (Human) (pPB-N-His) |
|
PV013570 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) EDN2 Protein Vector (Human) (pPM-C-HA) |
|
PV013571 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) EDN2 Protein Vector (Human) (pPM-C-His) |
|
PV013572 |
ABM |
500 ng |
EUR 329 |
 Recombinant Human EDN2 Protein, His, E.coli-1mg |
|
QP11746-HIS-1mg |
EnQuireBio |
1mg |
EUR 2757 |
 Recombinant Human EDN2 Protein, His, E.coli-20ug |
|
QP11746-HIS-20ug |
EnQuireBio |
20ug |
EUR 201 |
 Recombinant Human EDN2 Protein, His, E.coli-5ug |
|
QP11746-HIS-5ug |
EnQuireBio |
5ug |
EUR 155 |
 Edn2 3'UTR GFP Stable Cell Line |
|
TU155603 |
ABM |
1.0 ml |
Ask for price |
 Edn2 3'UTR Luciferase Stable Cell Line |
|
TU105603 |
ABM |
1.0 ml |
Ask for price |
Edn2 3'UTR Luciferase Stable Cell Line |
|
TU203781 |
ABM |
1.0 ml |
Ask for price |
Edn2 3'UTR GFP Stable Cell Line |
|
TU253781 |
ABM |
1.0 ml |
Ask for price |
 EDN2 3'UTR GFP Stable Cell Line |
|
TU056565 |
ABM |
1.0 ml |
EUR 1394 |
 EDN2 3'UTR Luciferase Stable Cell Line |
|
TU006565 |
ABM |
1.0 ml |
EUR 1394 |
 : 96 Wells (OKEH00573)) EDN2 ELISA Kit (Human) : 96 Wells (OKEH00573) |
|
OKEH00573 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Endothelins are endothelium-derived vasoconstrictor peptides.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
EDN2 Rabbit Polyclonal Antibody
