EDN2 Rabbit Polyclonal Antibody
 EDN2 Polyclonal Antibody |
|
ABP58455-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein |
EDN2 Polyclonal Antibody |
|
ABP58455-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EDN2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of EDN2 from Human, Mouse, Rat. This EDN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDN2 protein |
 ELISA Kit) Human Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Hu-48T |
DL Develop |
48T |
EUR 463 |
- Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Hu-96T |
DL Develop |
96T |
EUR 599 |
- Should the Human Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Endothelin 2 (EDN2) in samples from serum, plasma or other biological fluids. |
 ELISA Kit) Rat Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Ra-48T |
DL Develop |
48T |
EUR 495 |
- Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
DLR-EDN2-Ra-96T |
DL Develop |
96T |
EUR 644 |
- Should the Rat Endothelin 2 (EDN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Endothelin 2 (EDN2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 481 |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 665 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 519 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RDR-EDN2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 720 |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 460 |
Human Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 636 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 496 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
RD-EDN2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 688 |
 EDN2 antibody |
|
70R-9137 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal EDN2 antibody |
 EDN2 Antibody |
|
35734-100ul |
SAB |
100ul |
EUR 252 |
EDN2 antibody |
|
70R-16997 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal EDN2 antibody |
EDN2 Antibody |
|
1-CSB-PA007401GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
EDN2 Antibody |
|
1-CSB-PA161267 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
EDN2 Antibody |
|
1-CSB-PA168757 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
EDN2 Antibody |
|
1-CSB-PA033256 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against EDN2. Recognizes EDN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
 Polyclonal Antibody (Human)) Endothelin 2 (EDN2) Polyclonal Antibody (Human) |
|
4-PAF415Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2) |
 EDN2 Conjugated Antibody |
|
C35734 |
SAB |
100ul |
EUR 397 |
 Anti-EDN2 antibody |
|
STJ192244 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to EDN2 |
 Polyclonal Antibody (Human), APC) Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC |
|
4-PAF415Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Endothelin 2 (EDN2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAF415Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Endothelin 2 (EDN2) Polyclonal Antibody (Human), Cy3 |
|
4-PAF415Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Endothelin 2 (EDN2) Polyclonal Antibody (Human), FITC |
|
4-PAF415Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Endothelin 2 (EDN2) Polyclonal Antibody (Human), HRP |
|
4-PAF415Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Endothelin 2 (EDN2) Polyclonal Antibody (Human), PE |
|
4-PAF415Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with PE. |
 EDN2 siRNA |
|
20-abx901638 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDN2 siRNA |
|
20-abx914960 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDN2 siRNA |
|
20-abx914961 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Endothelin 2 (EDN2) Antibody |
|
20-abx112293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx128276 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelin 2 (EDN2) Antibody |
|
abx027651-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
abx027651-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx172237 |
Abbexa |
|
|
|
|
Endothelin 2 (EDN2) Antibody |
|
20-abx172238 |
Abbexa |
|
|
|
|
Endothelin 2 (EDN2) Antibody |
|
20-abx176270 |
Abbexa |
|
|
|
|
Endothelin 2 (EDN2) Antibody |
|
20-abx339841 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx210820 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelin 2 (EDN2) Antibody |
|
20-abx211230 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Endothelin 2 (EDN2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAF415Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EDN2 (Gln32~Arg178)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelin 2 (EDN2). This antibody is labeled with APC-Cy7. |
 EDN2 cloning plasmid |
|
CSB-CL007401HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atggtctccgtgcctaccacctggtgctccgttgcgctagccctgctcgtggccctgcatgaagggaagggccaggctgctgccaccctggagcagccagcgtcctcatctcatgcccaaggcacccaccttcggcttcgccgttgctcctgcagctcctggctcgacaaggagtg
- Show more
|
|
Description: A cloning plasmid for the EDN2 gene. |
 EDN2 Blocking Peptide |
|
33R-6611 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDN2 antibody, catalog no. 70R-9137 |
 Rat EDN2 shRNA Plasmid |
|
20-abx984439 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Protein) Endothelin 2 (EDN2) Protein |
|
20-abx260088 |
Abbexa |
-
EUR 328.00
-
EUR 2736.00
-
EUR 787.00
|
|
- Shipped within 5-10 working days.
|
 Human EDN2 shRNA Plasmid |
|
20-abx951326 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) EDN2 protein (His tag) |
|
80R-2705 |
Fitzgerald |
100 ug |
EUR 322 |
|
Description: Purified recombinant EDN2 protein (His tag) |
 Mouse EDN2 shRNA Plasmid |
|
20-abx970107 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) Recombinant Endothelin 2 (EDN2) |
|
4-RPF415Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P20800
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 20.5kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Endothelin 2 expressed in: E.coli |
) EDN2 Recombinant Protein (Human) |
|
RP010177 |
ABM |
100 ug |
Ask for price |
) EDN2 Recombinant Protein (Rat) |
|
RP199061 |
ABM |
100 ug |
Ask for price |
) EDN2 Recombinant Protein (Mouse) |
|
RP130874 |
ABM |
100 ug |
Ask for price |
 Protein) Rat Endothelin 2 (EDN2) Protein |
|
20-abx653272 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Protein) Human Endothelin 2 (EDN2) Protein |
|
20-abx166607 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (pORF)) EDN2 ORF Vector (Human) (pORF) |
|
ORF003393 |
ABM |
1.0 ug DNA |
EUR 95 |
 EDN2 Human Endothelin-2 protein |
|
PROTP20800-1 |
BosterBio |
Regular: 5mg |
EUR 697 |
|
Description: EDN2 contains 21 amino acids having a molecular mass of 2546.97 Dalton. |
 (pORF)) Edn2 ORF Vector (Rat) (pORF) |
|
ORF066355 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Edn2 ORF Vector (Mouse) (pORF) |
|
ORF043626 |
ABM |
1.0 ug DNA |
EUR 506 |
 (M01), Clone: 3B4-1C5) Monoclonal EDN2 Antibody (monoclonal) (M01), Clone: 3B4-1C5 |
|
AMM03480G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human EDN2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3B4-1C5. This antibody is applicable in WB |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Endothelin 2 (EDN2) in serum, plasma and other biological fluids. |
Human Endothelin 2 (EDN2) ELISA Kit |
|
4-CEF415Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
- PPET2
- Preproendothelin-2
|
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Endothelin 2 (EDN2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
CEF415Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Endothelin 2 (EDN2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Endothelin 2 (EDN2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
4-CEF415Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Endothelin 2 elisa. Alternative names of the recognized antigen: ET2
- PPET2
- Preproendothelin-2
|
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Endothelin 2 (EDN2) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 ELISA Kit) Cow Endothelin 2 (EDN2) ELISA Kit |
|
abx519466-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Dog Endothelin 2 (EDN2) ELISA Kit |
|
abx519467-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Endothelin 2 (EDN2) ELISA Kit |
|
abx575853-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Endothelin 2 (EDN2) ELISA Kit |
|
abx576570-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 Human EDN2/ Endothelin-2 ELISA Kit |
|
E0758Hu |
Sunlong |
1 Kit |
EUR 571 |
 Mouse Edn2/ Endothelin-2 ELISA Kit |
|
E1635Mo |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human EDN2(Endothelin-2) ELISA Kit |
|
EH2114 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.781-50 pg/ml
- Uniprot ID: P20800
- Alias: ET-2/Preproendothelin-2(PPET2)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469pg/ml |
 ELISA Kit) Mouse Edn2(Endothelin-2) ELISA Kit |
|
EM0727 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: P22389
- Alias: Edn2/ET-2/Preproendothelin-2(PPET2)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml |
) EDN2 sgRNA CRISPR Lentivector set (Human) |
|
K0654001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat Endothelin 2 (EDN2) ELISA Kit |
|
20-abx155474 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Endothelin 2 (EDN2) ELISA Kit |
|
20-abx156808 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Human Endothelin 2 (EDN2) CLIA Kit |
|
20-abx490518 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 CLIA Kit) Rat Endothelin 2 (EDN2) CLIA Kit |
|
20-abx490519 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 ELISA Kit) Mouse Endothelin 2 (EDN2) ELISA Kit |
|
abx255075-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
) Edn2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3710801 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA Kit) Human Endothelin-2(EDN2)ELISA Kit |
|
CSB-E16518h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Endothelin-2(EDN2)ELISA Kit |
|
1-CSB-E16518h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA kit) Mouse Endothelin-2(EDN2) ELISA kit |
|
CSB-EL007401MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2 (EDN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Endothelin-2(EDN2) ELISA kit |
|
1-CSB-EL007401MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Endothelin-2(EDN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
) Edn2 sgRNA CRISPR Lentivector set (Rat) |
|
K6886201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ELISA kit for Human EDN2 (Endothelin 2) |
|
ELK5069 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
- Show more
|
|
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Rat EDN2 (Endothelin 2) |
|
ELK6274 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- A monoclonal antibody specific to Endothelin 2 (EDN2) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Endothelin 2 (EDN2) and unlabeled Endothelin 2 (EDN2) (Standards or samples) with the pr
- Show more
|
|
Description: A competitive Inhibition ELISA kit for detection of Endothelin 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
 (Target 1)) EDN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0654002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) EDN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0654003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) EDN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0654004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3710802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3710803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Edn2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3710804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Edn2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6886202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Edn2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6886203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Edn2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6886204 |
ABM |
1.0 ug DNA |
EUR 154 |
) ELISA kit for Human Endothelin-2 (EDN2) |
|
KTE61953-48T |
Abbkine |
48T |
EUR 332 |
- Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Endothelin-2 (EDN2) |
|
KTE61953-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Endothelin-2 (EDN2) |
|
KTE61953-96T |
Abbkine |
96T |
EUR 539 |
- Endothelin 2 is a member of the endothelin protein family of secretory vasoconstrictive peptides. The preproprotein is processed to a short mature form which functions as a ligand for the endothelin receptors that initiate intracellular signaling eve
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Endothelin-2 (EDN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 (pPB-C-His)) EDN2 Protein Vector (Mouse) (pPB-C-His) |
|
PV174502 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EDN2 Protein Vector (Mouse) (pPB-N-His) |
|
PV174503 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EDN2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV174504 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EDN2 Protein Vector (Mouse) (pPM-C-His) |
|
PV174505 |
ABM |
500 ng |
EUR 603 |
 Recombinant Human EDN2 Protein, His, E.coli-1mg |
|
QP11746-HIS-1mg |
EnQuireBio |
1mg |
EUR 2757 |
 Recombinant Human EDN2 Protein, His, E.coli-20ug |
|
QP11746-HIS-20ug |
EnQuireBio |
20ug |
EUR 201 |
 Recombinant Human EDN2 Protein, His, E.coli-5ug |
|
QP11746-HIS-5ug |
EnQuireBio |
5ug |
EUR 155 |
 (pPB-C-His)) EDN2 Protein Vector (Human) (pPB-C-His) |
|
PV013569 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) EDN2 Protein Vector (Human) (pPB-N-His) |
|
PV013570 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) EDN2 Protein Vector (Human) (pPM-C-HA) |
|
PV013571 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) EDN2 Protein Vector (Human) (pPM-C-His) |
|
PV013572 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) EDN2 Protein Vector (Rat) (pPB-C-His) |
|
PV265418 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) EDN2 Protein Vector (Rat) (pPB-N-His) |
|
PV265419 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) EDN2 Protein Vector (Rat) (pPM-C-HA) |
|
PV265420 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) EDN2 Protein Vector (Rat) (pPM-C-His) |
|
PV265421 |
ABM |
500 ng |
EUR 603 |
 Edn2 3'UTR Luciferase Stable Cell Line |
|
TU203781 |
ABM |
1.0 ml |
Ask for price |
 Edn2 3'UTR GFP Stable Cell Line |
|
TU155603 |
ABM |
1.0 ml |
Ask for price |
 EDN2 3'UTR Luciferase Stable Cell Line |
|
TU006565 |
ABM |
1.0 ml |
EUR 1394 |
Edn2 3'UTR Luciferase Stable Cell Line |
|
TU105603 |
ABM |
1.0 ml |
Ask for price |
 EDN2 3'UTR GFP Stable Cell Line |
|
TU056565 |
ABM |
1.0 ml |
EUR 1394 |
Edn2 3'UTR GFP Stable Cell Line |
|
TU253781 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
EDN2 Rabbit Polyclonal Antibody
