EHMT2 Rabbit Polyclonal Antibody
EHMT2 Polyclonal Antibody |
ABP58465-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450
- Applications tips:
|
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450 |
EHMT2 Polyclonal Antibody |
ABP58465-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450
- Applications tips:
|
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450 |
EHMT2 Polyclonal Antibody |
ABP58465-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450
- Applications tips:
|
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450 |
EHMT2 Polyclonal Antibody |
A-3019 |
EpiGentek |
100 µl |
EUR 616.95 |
Description: reagents widely cited |
EHMT2 Rabbit pAb |
A1247-100ul |
Abclonal |
100 ul |
EUR 308 |
EHMT2 Rabbit pAb |
A1247-200ul |
Abclonal |
200 ul |
EUR 459 |
EHMT2 Rabbit pAb |
A1247-20ul |
Abclonal |
20 ul |
EUR 183 |
EHMT2 Rabbit pAb |
A1247-50ul |
Abclonal |
50 ul |
EUR 223 |
EHMT2 Rabbit pAb |
A2295-100ul |
Abclonal |
100 ul |
EUR 308 |
EHMT2 Rabbit pAb |
A2295-200ul |
Abclonal |
200 ul |
EUR 459 |
EHMT2 Rabbit pAb |
A2295-20ul |
Abclonal |
20 ul |
Ask for price |
EHMT2 Rabbit pAb |
A2295-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal EHMT2 Antibody (Center) |
AMM07023G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EHMT2 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal EHMT2 Antibody (Center) |
APC00113G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EHMT2 (Center). This antibody is tested and proven to work in the following applications: |
EHMT2 antibody |
70R-7930 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal EHMT2 antibody |
EHMT2 Antibody |
32257-100ul |
SAB |
100ul |
EUR 252 |
EHMT2 antibody |
70R-17027 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EHMT2 antibody |
EHMT2 Antibody |
DF6379 |
Affbiotech |
200ul |
EUR 304 |
Description: EHMT2 Antibody detects endogenous levels of total EHMT2. |
EHMT2 Antibody |
1-CSB-PA007497GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EHMT2. Recognizes EHMT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal (Mouse) Ehmt2 Antibody (Center) |
AMM08708G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Ehmt2 (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal (Mouse) Ehmt2 Antibody (N-term) |
AMM08709G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Ehmt2 (N-term). This antibody is tested and proven to work in the following applications: |
EHMT2 Conjugated Antibody |
C32257 |
SAB |
100ul |
EUR 397 |
EHMT2 / G9a Antibody |
abx232679-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-EHMT2 Antibody |
A1676-100 |
Biovision |
|
EUR 479 |
Anti-EHMT2 antibody |
STJ23499 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. |
Anti-EHMT2 antibody |
STJ23500 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. |
Anti-EHMT2 antibody |
STJ192390 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EHMT2 |
EHMT2 siRNA |
20-abx915107 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EHMT2 siRNA |
20-abx915108 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti- EHMT2/G9a antibody |
FNab02679 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: euchromatic histone-lysine N-methyltransferase 2
- Uniprot ID: Q96KQ7
- Research Area: Stem cells, Epigenetics, Developmental biology
|
Description: Antibody raised against EHMT2/G9a |
EHMT2 Blocking Peptide |
33R-9760 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EHMT2 antibody, catalog no. 70R-7930 |
EHMT2 Blocking Peptide |
DF6379-BP |
Affbiotech |
1mg |
EUR 195 |
EHMT2 cloning plasmid |
CSB-CL846653HU-10ug |
Cusabio |
10ug |
EUR 1112 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3006
- Sequence: atgagtgatgatgtccactcactgggaaaggtgacctcagatctggccaaaaggaggaagctgaactcaggaggtggcctgtcggaggagttaggttctgcccggcgttcaggagaagtgaccctgacgaaaggggaccccgggtccctggaggagtgggagacggtggtgggtg
- Show more
|
Description: A cloning plasmid for the EHMT2 gene. |
Ehmt2 ELISA Kit| Mouse Histone-lysine N-methyltransferase EHMT2 |
EF014211 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse EHMT2 shRNA Plasmid |
20-abx980051 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EHMT2 shRNA Plasmid |
20-abx957446 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
G9a/Ehmt2 (anti G9a antibody, clone# A8620A) |
PP-A8620A-00 |
Sceti |
0.1mg/100uL |
EUR 623 |
Description: The G9a/Ehmt2 (anti G9a antibody, clone# A8620A) is available in Europe and for worldwide shipping via Gentaur. |
EHMT2 ORF Vector (Human) (pORF) |
ORF003444 |
ABM |
1.0 ug DNA |
EUR 95 |
Ehmt2 ORF Vector (Rat) (pORF) |
ORF066421 |
ABM |
1.0 ug DNA |
EUR 506 |
Ehmt2 ORF Vector (Mouse) (pORF) |
ORF043720 |
ABM |
1.0 ug DNA |
EUR 506 |
Ehmt2 ORF Vector (Mouse) (pORF) |
ORF043721 |
ABM |
1.0 ug DNA |
EUR 506 |
Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody |
20-abx112346 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody |
20-abx001159 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody |
20-abx001867 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EHMT2 sgRNA CRISPR Lentivector set (Human) |
K0663801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ehmt2 sgRNA CRISPR Lentivector set (Mouse) |
K4341101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ehmt2 sgRNA CRISPR Lentivector set (Rat) |
K7325301 |
ABM |
3 x 1.0 ug |
EUR 339 |
EHMT2-AS1 ORF Vector (Human) (pORF) |
ORF018770 |
ABM |
1.0 ug DNA |
Ask for price |
EHMT2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0663802 |
ABM |
1.0 ug DNA |
EUR 154 |
EHMT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0663803 |
ABM |
1.0 ug DNA |
EUR 154 |
EHMT2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0663804 |
ABM |
1.0 ug DNA |
EUR 154 |
Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4341102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4341103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4341104 |
ABM |
1.0 ug DNA |
EUR 154 |
Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7325302 |
ABM |
1.0 ug DNA |
EUR 154 |
Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7325303 |
ABM |
1.0 ug DNA |
EUR 154 |
Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7325304 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant human Histone-lysine N-methyltransferase EHMT2 |
P1681 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q96KQ7
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Histone-lysine N-methyltransferase EHMT2 |
EHMT2 Protein Vector (Mouse) (pPB-C-His) |
PV174878 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPB-N-His) |
PV174879 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPM-C-HA) |
PV174880 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPM-C-His) |
PV174881 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPB-C-His) |
PV174882 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPB-N-His) |
PV174883 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPM-C-HA) |
PV174884 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Mouse) (pPM-C-His) |
PV174885 |
ABM |
500 ng |
EUR 1065 |
EHMT2 Protein Vector (Human) (pPB-C-His) |
PV013773 |
ABM |
500 ng |
EUR 329 |
EHMT2 Protein Vector (Human) (pPB-N-His) |
PV013774 |
ABM |
500 ng |
EUR 329 |
EHMT2 Protein Vector (Human) (pPM-C-HA) |
PV013775 |
ABM |
500 ng |
EUR 329 |
EHMT2 Protein Vector (Human) (pPM-C-His) |
PV013776 |
ABM |
500 ng |
EUR 329 |
EHMT2 Protein Vector (Rat) (pPB-C-His) |
PV265682 |
ABM |
500 ng |
EUR 1191 |
EHMT2 Protein Vector (Rat) (pPB-N-His) |
PV265683 |
ABM |
500 ng |
EUR 1191 |
EHMT2 Protein Vector (Rat) (pPM-C-HA) |
PV265684 |
ABM |
500 ng |
EUR 1191 |
EHMT2 Protein Vector (Rat) (pPM-C-His) |
PV265685 |
ABM |
500 ng |
EUR 1191 |
Ehmt2 3'UTR Luciferase Stable Cell Line |
TU203852 |
ABM |
1.0 ml |
Ask for price |
Ehmt2 3'UTR GFP Stable Cell Line |
TU155683 |
ABM |
1.0 ml |
Ask for price |
EHMT2 3'UTR Luciferase Stable Cell Line |
TU006692 |
ABM |
1.0 ml |
EUR 1394 |
Ehmt2 3'UTR Luciferase Stable Cell Line |
TU105683 |
ABM |
1.0 ml |
Ask for price |
EHMT2 3'UTR GFP Stable Cell Line |
TU056692 |
ABM |
1.0 ml |
EUR 1394 |
Ehmt2 3'UTR GFP Stable Cell Line |
TU253852 |
ABM |
1.0 ml |
Ask for price |
EHMT2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV633001 |
ABM |
1.0 ug DNA |
EUR 1355 |
EHMT2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV633005 |
ABM |
1.0 ug DNA |
EUR 1355 |
EHMT2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV633006 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
EHMT2 Rabbit Polyclonal Antibody