EHMT2 Rabbit Polyclonal Antibody

EHMT2 Polyclonal Antibody
ABP58465-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450 Applications tips:
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450

EHMT2 Polyclonal Antibody
ABP58465-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450 Applications tips:
Description: A polyclonal antibody for detection of EHMT2 from Human, Mouse. This EHMT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EHMT2 protein at amino acid sequence of 370-450

EHMT2 Polyclonal Antibody
ES11232-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against EHMT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EHMT2 Polyclonal Antibody
ES11232-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against EHMT2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EHMT2 Rabbit pAb
A1247-100ul	Abclonal	100 ul	EUR 308

EHMT2 Rabbit pAb
A1247-200ul	Abclonal	200 ul	EUR 459

EHMT2 Rabbit pAb
A1247-20ul	Abclonal	20 ul	EUR 183

EHMT2 Rabbit pAb
A1247-50ul	Abclonal	50 ul	EUR 223

EHMT2 Rabbit pAb
A2295-100ul	Abclonal	100 ul	EUR 308

EHMT2 Rabbit pAb
A2295-200ul	Abclonal	200 ul	EUR 459

EHMT2 Rabbit pAb
A2295-20ul	Abclonal	20 ul	Ask for price

EHMT2 Rabbit pAb
A2295-50ul	Abclonal	50 ul	Ask for price

Polyclonal EHMT2 Antibody (Center)
APC00113G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EHMT2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal EHMT2 Antibody (Center)
AMM07023G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EHMT2 (Center). This antibody is tested and proven to work in the following applications:

EHMT2 antibody
70R-17027	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EHMT2 antibody

EHMT2 Antibody
32257-100ul	SAB	100ul	EUR 252

EHMT2 Antibody
6152-100	Biovision		EUR 414

EHMT2 Antibody
DF6379	Affbiotech	200ul	EUR 304
Description: EHMT2 Antibody detects endogenous levels of total EHMT2.

EHMT2 antibody
70R-7930	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal EHMT2 antibody

EHMT2 Antibody
1-CSB-PA007497GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EHMT2. Recognizes EHMT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EHMT2 Antibody
ABD6379	Lifescience Market	100 ug	EUR 438

Polyclonal (Mouse) Ehmt2 Antibody (Center)
AMM08708G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Ehmt2 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal (Mouse) Ehmt2 Antibody (N-term)
AMM08709G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Ehmt2 (N-term). This antibody is tested and proven to work in the following applications:

EHMT2 Conjugated Antibody
C32257	SAB	100ul	EUR 397

EHMT2 / G9a Antibody
abx232679-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-EHMT2 Antibody
A1676-100	Biovision		EUR 479

Anti-EHMT2 antibody
STJ23499	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants.

Anti-EHMT2 antibody
STJ23500	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants.

Anti-EHMT2 antibody
STJ192390	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EHMT2

EHMT2 siRNA
20-abx915107	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EHMT2 siRNA
20-abx915108	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pOTB7-EHMT2
PVT18033	Lifescience Market	2 ug	EUR 300

anti- EHMT2/G9a antibody
FNab02679	FN Test	100µg	EUR 505.25
Immunogen: euchromatic histone-lysine N-methyltransferase 2 Uniprot ID: Q96KQ7 Research Area: Stem cells, Epigenetics, Developmental biology
Description: Antibody raised against EHMT2/G9a

Anti-EHMT2/G9a antibody
PAab02679	Lifescience Market	100 ug	EUR 355

EHMT2 Blocking Peptide
33R-9760	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EHMT2 antibody, catalog no. 70R-7930

EHMT2 Blocking Peptide
DF6379-BP	Affbiotech	1mg	EUR 195

EHMT2 cloning plasmid
CSB-CL846653HU-10ug	Cusabio	10ug	EUR 1112
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3006 Sequence: atgagtgatgatgtccactcactgggaaaggtgacctcagatctggccaaaaggaggaagctgaactcaggaggtggcctgtcggaggagttaggttctgcccggcgttcaggagaagtgaccctgacgaaaggggaccccgggtccctggaggagtgggagacggtggtgggtg Show more
Description: A cloning plasmid for the EHMT2 gene.

EHMT2-IN-1
HY-111778	MedChemExpress	10mM/1mL	EUR 744

EHMT2-IN-2
HY-111904	MedChemExpress	10mg	EUR 1025

pOTB7-EHMT2 Plasmid
PVTB01045-1	Lifescience Market	2 ug	EUR 356

pCMV-SPORT6-EHMT2
PVT18089	Lifescience Market	2 ug	EUR 300

pEnCMV-EHMT2-3
PVT18614	Lifescience Market	2 ug	EUR 341

Ehmt2 ELISA Kit| Mouse Histone-lysine N-methyltransferase EHMT2
EF014211	Lifescience Market	96 Tests	EUR 689

Human EHMT2 ELISA KIT
ELI-26579h	Lifescience Market	96 Tests	EUR 824

EHMT2 ELISA KIT|Human
EF010427	Lifescience Market	96 Tests	EUR 689

Human EHMT2 shRNA Plasmid
20-abx957446	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EHMT2 shRNA Plasmid
20-abx980051	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Ehmt2 ELISA KIT
ELI-47578m	Lifescience Market	96 Tests	EUR 865

G9a/Ehmt2 (anti G9a antibody, clone# A8620A)
PP-A8620A-00	Sceti	0.1mg/100uL	EUR 623
Description: The G9a/Ehmt2 (anti G9a antibody, clone# A8620A) is available in Europe and for worldwide shipping via Gentaur.

Ehmt2 ORF Vector (Rat) (pORF)
ORF066421	ABM	1.0 ug DNA	EUR 506

EHMT2 ORF Vector (Human) (pORF)
ORF003444	ABM	1.0 ug DNA	EUR 95

Ehmt2 ORF Vector (Mouse) (pORF)
ORF043720	ABM	1.0 ug DNA	EUR 506

Ehmt2 ORF Vector (Mouse) (pORF)
ORF043721	ABM	1.0 ug DNA	EUR 506

Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody
20-abx112346	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody
20-abx001159	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Euchromatic Histone-Lysine N-Methyltransferase 2 (EHMT2) Antibody
20-abx001867	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

EHMT2 sgRNA CRISPR Lentivector set (Human)
K0663801	ABM	3 x 1.0 ug	EUR 339

Ehmt2 sgRNA CRISPR Lentivector set (Rat)
K7325301	ABM	3 x 1.0 ug	EUR 339

Ehmt2 sgRNA CRISPR Lentivector set (Mouse)
K4341101	ABM	3 x 1.0 ug	EUR 339

EHMT2-AS1 ORF Vector (Human) (pORF)
ORF018770	ABM	1.0 ug DNA	Ask for price

EHMT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0663802	ABM	1.0 ug DNA	EUR 154

EHMT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0663803	ABM	1.0 ug DNA	EUR 154

EHMT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0663804	ABM	1.0 ug DNA	EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7325302	ABM	1.0 ug DNA	EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7325303	ABM	1.0 ug DNA	EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7325304	ABM	1.0 ug DNA	EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4341102	ABM	1.0 ug DNA	EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4341103	ABM	1.0 ug DNA	EUR 154

Ehmt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4341104	ABM	1.0 ug DNA	EUR 154

Recombinant human Histone-lysine N-methyltransferase EHMT2
P1681	FN Test	100ug	Ask for price
Uniprot ID: Q96KQ7 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Histone-lysine N-methyltransferase EHMT2

EHMT2 Protein Vector (Mouse) (pPB-C-His)
PV174878	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPB-N-His)
PV174879	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-HA)
PV174880	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-His)
PV174881	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPB-C-His)
PV174882	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPB-N-His)
PV174883	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-HA)
PV174884	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Mouse) (pPM-C-His)
PV174885	ABM	500 ng	EUR 1065

EHMT2 Protein Vector (Rat) (pPB-C-His)
PV265682	ABM	500 ng	EUR 1191

EHMT2 Protein Vector (Rat) (pPB-N-His)
PV265683	ABM	500 ng	EUR 1191

EHMT2 Protein Vector (Rat) (pPM-C-HA)
PV265684	ABM	500 ng	EUR 1191

EHMT2 Protein Vector (Rat) (pPM-C-His)
PV265685	ABM	500 ng	EUR 1191

EHMT2 Protein Vector (Human) (pPB-C-His)
PV013773	ABM	500 ng	EUR 329

EHMT2 Protein Vector (Human) (pPB-N-His)
PV013774	ABM	500 ng	EUR 329

EHMT2 Protein Vector (Human) (pPM-C-HA)
PV013775	ABM	500 ng	EUR 329

EHMT2 Protein Vector (Human) (pPM-C-His)
PV013776	ABM	500 ng	EUR 329

Ehmt2 3'UTR GFP Stable Cell Line
TU155683	ABM	1.0 ml	Ask for price

Ehmt2 3'UTR Luciferase Stable Cell Line
TU105683	ABM	1.0 ml	Ask for price

Ehmt2 3'UTR Luciferase Stable Cell Line
TU203852	ABM	1.0 ml	Ask for price

Ehmt2 3'UTR GFP Stable Cell Line
TU253852	ABM	1.0 ml	Ask for price

EHMT2 3'UTR GFP Stable Cell Line
TU056692	ABM	1.0 ml	EUR 1394

EHMT2 3'UTR Luciferase Stable Cell Line
TU006692	ABM	1.0 ml	EUR 1394

EHMT2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV633001	ABM	1.0 ug DNA	EUR 1355

EHMT2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV633005	ABM	1.0 ug DNA	EUR 1355

EHMT2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV633006	ABM	1.0 ug DNA	EUR 1355

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EHMT2 Rabbit Polyclonal Antibody