EPYC Rabbit Polyclonal Antibody

EPYC Rabbit Polyclonal Antibody

Human Epiphycan (EPYC) ELISA Kit
RD-EPYC-Hu-48Tests 48 Tests
EUR 521

Human Epiphycan (EPYC) ELISA Kit
RD-EPYC-Hu-96Tests 96 Tests
EUR 723

EPYC Polyclonal Antibody
ABP58493-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody
ABP58493-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody
ABP58493-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of EPYC from Human, Mouse. This EPYC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPYC protein at amino acid sequence of 140-220

EPYC Polyclonal Antibody
ES11217-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EPYC Polyclonal Antibody
ES11217-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EPYC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal EPYC Antibody - middle region
APR15856G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EPYC - middle region. This antibody is tested and proven to work in the following applications:

Epiphycan (EPYC) Polyclonal Antibody (Human)
4-PAJ227Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC)

Rabbit Epiphycan (EPYC) ELISA Kit
abx355328-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Epiphycan (EPYC) Polyclonal Antibody (Human), APC
4-PAJ227Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Human), Biotinylated
4-PAJ227Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Human), Cy3
4-PAJ227Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Human), FITC
4-PAJ227Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Human), HRP
4-PAJ227Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Human), PE
4-PAJ227Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat)
4-PAJ227Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC)

Epiphycan (EPYC) Antibody
20-abx100319
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody
20-abx129601
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Epiphycan (EPYC) Antibody
20-abx172275
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-EPYC antibody
STJ192375 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EPYC

EPYC siRNA
20-abx915572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EPYC siRNA
20-abx915573
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Epiphycan (EPYC) Polyclonal Antibody (Human), APC-Cy7
4-PAJ227Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (His110~Pro317)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC
4-PAJ227Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAJ227Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Biotin.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAJ227Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with Cy3.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), FITC
4-PAJ227Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with FITC.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), HRP
4-PAJ227Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with HRP.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), PE
4-PAJ227Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with PE.

Epiphycan (EPYC) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAJ227Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EPYC (Cys130~Ile322)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Epiphycan (EPYC). This antibody is labeled with APC-Cy7.

EPYC cloning plasmid
CSB-CL007757HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgaagacattagcaggacttgttctgggacttgtcatctttgatgctgctgtgactgccccaactctagagtccatcaactatgactcagaaacctatgatgccaccttagaagacctggataatttgtacaactatgaaaacatacctgttggtaaagttgagattgaaatagc
  • Show more
Description: A cloning plasmid for the EPYC gene.

Recombinant Epiphycan (EPYC)
4-RPJ227Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99645
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Epiphycan expressed in: E.coli

Recombinant Epiphycan (EPYC)
4-RPJ227Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P70186
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.3kDa
  • Isoelectric Point: 6.9
Description: Recombinant Mouse Epiphycan expressed in: E.coli

Anti-EPYC (2G6)
YF-MA20319 100 ug
EUR 363
Description: Mouse monoclonal to EPYC

Mouse Epiphycan (EPYC) Protein
20-abx167271
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Epiphycan (EPYC) Protein
20-abx066448
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EPYC ELISA KIT|Human
EF006788 96 Tests
EUR 689

Mouse EPYC shRNA Plasmid
20-abx970068
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EPYC shRNA Plasmid
20-abx951282
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EPYC Recombinant Protein (Human)
RP010831 100 ug Ask for price

EPYC Recombinant Protein (Rat)
RP199832 100 ug Ask for price

EPYC Recombinant Protein (Mouse)
RP132080 100 ug Ask for price

Human Epiphycan (EPYC)ELISA Kit
201-12-2676 96 tests
EUR 440
  • This Epiphycan ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Epiphycan (EPYC) CLIA Kit
abx195548-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Epiphycan (EPYC) ELISA Kit
20-abx151434
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Epiphycan (EPYC) ELISA Kit
abx252401-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human EPYC(Epiphycan) ELISA Kit
EH3009 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99645
  • Alias: EPYC/PG-Lb/SLRR3B/Dermatan sulfate proteoglycan 3dermatan sulphate proteoglycan 3/DSPG3proteoglycan-lb/epiphycan/PGLB/Pg-Lb/PG-Lb/Proteoglycan-Lb/SLRR3Bepiphycan proteoglycan/Small chondroitin
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Bovine Epiphycan, EPYC ELISA KIT
ELI-26891b 96 Tests
EUR 928

Chicken Epiphycan (EPYC) ELISA Kit
abx354637-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Epiphycan (EPYC) ELISA Kit
abx354912-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Epiphycan (EPYC) ELISA Kit
abx355061-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Epiphycan (EPYC) CLIA Kit
20-abx495642
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Epiphycan, Epyc ELISA KIT
ELI-32781m 96 Tests
EUR 865

Human Epiphycan, EPYC ELISA KIT
ELI-47275h 96 Tests
EUR 824

Chicken Epiphycan, EPYC ELISA KIT
ELI-47715c 96 Tests
EUR 928

Epyc ORF Vector (Rat) (pORF)
ORF066612 1.0 ug DNA
EUR 506

EPYC ORF Vector (Human) (pORF)
ORF003611 1.0 ug DNA
EUR 95

Epyc ORF Vector (Mouse) (pORF)
ORF044028 1.0 ug DNA
EUR 506

Human Epiphycan(EPYC)ELISA Kit
QY-E03113 96T
EUR 361

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
SEJ227Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Epiphycan (EPYC) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Epiphycan (EPYC) in Tissue homogenates and other biological fluids.

Human Epiphycan (EPYC) ELISA Kit
4-SEJ227Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Epiphycan elisa. Alternative names of the recognized antigen: DSPG3
  • Pg-Lb
  • SLRR3B
  • Dermatan Sulphate Proteoglycan 3
  • Dermatan Sulfate Proteoglycan 3
  • Proteoglycan-Lb
  • Small chondroitin/dermatan sulfate proteoglycan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Epiphycan (EPYC) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

EPYC ELISA Kit (Human) (OKCD09160)
OKCD09160 96 Wells
EUR 975
Description: Description of target: Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

EPYC ELISA Kit (Human) (OKDD00254)
OKDD00254 96 Wells
EUR 975
Description: Description of target: Dermatan sulfate proteoglycan 3 is a member of the small leucine-rich repeat proteoglycan family. This gene is composed of seven exons. It regulates fibrillogenesis by interacting with collagen fibrils and other extracellular matrix proteins.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.056 ng/mL

ELISA kit for Human EPYC (Epiphycan)
E-EL-H0370 1 plate of 96 wells
EUR 534
  • Gentaur's EPYC ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human EPYC (Epiphycan)
E-CL-H0301 1 plate of 96 wells
EUR 584
  • Gentaur's EPYC CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human EPYC . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human EPYC (Epiphycan) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human EPYC (Epiphycan)
ELK3102 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Epiphycan (EPYC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Epiphycan (EPYC).
  • Show more
Description: A sandwich ELISA kit for detection of Epiphycan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Epiphycan (EPYC) ELISA Kit
abx354871-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

EPYC sgRNA CRISPR Lentivector set (Human)
K0689901 3 x 1.0 ug
EUR 339

Epyc sgRNA CRISPR Lentivector set (Rat)
K6018501 3 x 1.0 ug
EUR 339

Epyc sgRNA CRISPR Lentivector set (Mouse)
K3405101 3 x 1.0 ug
EUR 339

EPYC sgRNA CRISPR Lentivector (Human) (Target 1)
K0689902 1.0 ug DNA
EUR 154

EPYC sgRNA CRISPR Lentivector (Human) (Target 2)
K0689903 1.0 ug DNA
EUR 154

EPYC sgRNA CRISPR Lentivector (Human) (Target 3)
K0689904 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 1)
K6018502 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 2)
K6018503 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Rat) (Target 3)
K6018504 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3405102 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3405103 1.0 ug DNA
EUR 154

Epyc sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3405104 1.0 ug DNA
EUR 154

EPYC Rabbit Polyclonal Antibody