CelltaGen
셀타젠 Genetic Genotyping

ERMAP Rabbit Polyclonal Antibody

ERMAP Polyclonal Antibody

ABP58497-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ERMAP protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of ERMAP from Human, Mouse. This ERMAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ERMAP protein at amino acid sequence of 30-110

ERMAP Polyclonal Antibody

ES11213-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERMAP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ERMAP Polyclonal Antibody

ES11213-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERMAP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ERMAP Rabbit pAb

A10425-100ul 100 ul
EUR 308

ERMAP Rabbit pAb

A10425-200ul 200 ul
EUR 459

ERMAP Rabbit pAb

A10425-20ul 20 ul
EUR 183

ERMAP Rabbit pAb

A10425-50ul 50 ul
EUR 223

ERMAP Polyclonal Conjugated Antibody

C31940 100ul
EUR 397

ERMAP Polyclonal Conjugated Antibody

C27431 100ul
EUR 397

ERMAP antibody

31940-100ul 100ul
EUR 252

ERMAP antibody

31940-50ul 50ul
EUR 187

ERMAP antibody

10R-4029 100 ul
EUR 726
Description: Mouse monoclonal ERMAP antibody

ERMAP Antibody

39845-100ul 100ul
EUR 390

ERMAP antibody

70R-7347 50 ug
EUR 467
Description: Rabbit polyclonal ERMAP antibody

ERMAP antibody

70R-7360 50 ug
EUR 467
Description: Rabbit polyclonal ERMAP antibody

anti- ERMAP antibody

FNab02850 100µg
EUR 585
  • Immunogen: erythroblast membrane-associated protein(Scianna blood group)
  • Uniprot ID: Q96PL5
  • Gene ID: 114625
  • Research Area: Immunology
Description: Antibody raised against ERMAP

Anti-ERMAP antibody

PAab02850 100 ug
EUR 412

Anti-ERMAP antibody

STJ112457 100 µl
EUR 277
Description: The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene.

Anti-ERMAP antibody

STJ192371 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ERMAP

ERMAP siRNA

20-abx915648
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ERMAP siRNA

20-abx915649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ERMAP

YF-PA21865 50 ul
EUR 363
Description: Mouse polyclonal to ERMAP

anti-ERMAP

YF-PA21866 50 ug
EUR 363
Description: Mouse polyclonal to ERMAP

anti-ERMAP

YF-PA21867 100 ul
EUR 403
Description: Rabbit polyclonal to ERMAP

anti-ERMAP

YF-PA21868 100 ug
EUR 403
Description: Rabbit polyclonal to ERMAP

anti-ERMAP

YF-PA26813 50 ul
EUR 334
Description: Mouse polyclonal to ERMAP

ERMAP Blocking Peptide

33R-8176 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERMAP antibody, catalog no. 70R-7347

ERMAP Blocking Peptide

33R-6968 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERMAP antibody, catalog no. 70R-7360

ERMAP cloning plasmid

CSB-CL853480HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1428
  • Sequence: ATGGAGATGGCGAGTTCTGCTGGCTCCTGGCTCTCTGGCTGCCTCATCCCTCTCGTCTTCCTCCGGCTGTCTGTGCATGTGTCAGGCCACGCAGGGGATGCCGGCAAGTTCCACGTGGCCCTACTAGGGGGCACAGCCGAGCTGCTCTGCCCTCTCTCCCTCTGGCCCGGGACGG
  • Show more
Description: A cloning plasmid for the ERMAP gene.

anti-ERMAP (6F8)

LF-MA10101 100 ug
EUR 363
Description: Mouse monoclonal to ERMAP

ERMAP ELISA KIT|Human

EF009442 96 Tests
EUR 689

Human ERMAP shRNA Plasmid

20-abx964360
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ERMAP shRNA Plasmid

20-abx973817
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ERMAP Recombinant Protein (Human)

RP038803 100 ug Ask for price

ERMAP Recombinant Protein (Mouse)

RP132197 100 ug Ask for price

Monoclonal ERMAP Antibody (monoclonal) (M01), Clone: 6F8

APR15870G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ERMAP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6F8. This antibody is applicable in WB, E

ERMAP ORF Vector (Human) (pORF)

ORF012935 1.0 ug DNA
EUR 354

Ermap ORF Vector (Mouse) (pORF)

ORF044067 1.0 ug DNA
EUR 506

ERMAP sgRNA CRISPR Lentivector set (Human)

K0693301 3 x 1.0 ug
EUR 339

Ermap sgRNA CRISPR Lentivector set (Mouse)

K3499001 3 x 1.0 ug
EUR 339

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody

20-abx125825
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody

abx037092-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody

abx030390-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody

abx030390-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody

abx232850-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

ERMAP sgRNA CRISPR Lentivector (Human) (Target 1)

K0693302 1.0 ug DNA
EUR 154

ERMAP sgRNA CRISPR Lentivector (Human) (Target 2)

K0693303 1.0 ug DNA
EUR 154

ERMAP sgRNA CRISPR Lentivector (Human) (Target 3)

K0693304 1.0 ug DNA
EUR 154

Ermap sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3499002 1.0 ug DNA
EUR 154

Ermap sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3499003 1.0 ug DNA
EUR 154

Ermap sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3499004 1.0 ug DNA
EUR 154

ERMAP Protein Vector (Mouse) (pPB-C-His)

PV176266 500 ng
EUR 603

ERMAP Protein Vector (Mouse) (pPB-N-His)

PV176267 500 ng
EUR 603

ERMAP Protein Vector (Mouse) (pPM-C-HA)

PV176268 500 ng
EUR 603

ERMAP Protein Vector (Mouse) (pPM-C-His)

PV176269 500 ng
EUR 603

ERMAP Protein Vector (Human) (pPB-C-His)

PV051737 500 ng
EUR 481

ERMAP Protein Vector (Human) (pPB-N-His)

PV051738 500 ng
EUR 481

ERMAP Protein Vector (Human) (pPM-C-HA)

PV051739 500 ng
EUR 481

ERMAP Protein Vector (Human) (pPM-C-His)

PV051740 500 ng
EUR 481

Ermap 3'UTR GFP Stable Cell Line

TU155935 1.0 ml Ask for price

Ermap 3'UTR Luciferase Stable Cell Line

TU105935 1.0 ml Ask for price

Ermap 3'UTR Luciferase Stable Cell Line

TU204090 1.0 ml Ask for price

Ermap 3'UTR GFP Stable Cell Line

TU254090 1.0 ml Ask for price

ERMAP 3'UTR GFP Stable Cell Line

TU057025 1.0 ml
EUR 1521

ERMAP 3'UTR Luciferase Stable Cell Line

TU007025 1.0 ml
EUR 1521

Human Erythroid membrane- associated protein, ERMAP ELISA KIT

ELI-08316h 96 Tests
EUR 824

Human Erythroid Membrane-Associated Protein (ERMAP) ELISA Kit

abx387188-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Erythroid Membrane-Associated Protein (ERMAP) ELISA Kit

abx389195-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Erythroid membrane- associated protein, Ermap ELISA KIT

ELI-32770m 96 Tests
EUR 865

Ermap ELISA Kit| Mouse Erythroid membrane-associated protein EL

EF014825 96 Tests
EUR 689

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

ERMAP Rabbit Polyclonal Antibody