ERMAP Rabbit Polyclonal Antibody

ERMAP Polyclonal Antibody
ABP58497-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ERMAP protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of ERMAP from Human, Mouse. This ERMAP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ERMAP protein at amino acid sequence of 30-110

ERMAP Polyclonal Antibody
ES11213-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERMAP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ERMAP Polyclonal Antibody
ES11213-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERMAP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ERMAP Rabbit pAb
A10425-100ul	Abclonal	100 ul	EUR 308

ERMAP Rabbit pAb
A10425-200ul	Abclonal	200 ul	EUR 459

ERMAP Rabbit pAb
A10425-20ul	Abclonal	20 ul	EUR 183

ERMAP Rabbit pAb
A10425-50ul	Abclonal	50 ul	EUR 223

ERMAP Polyclonal Conjugated Antibody
C31940	SAB	100ul	EUR 397

ERMAP Polyclonal Conjugated Antibody
C27431	SAB	100ul	EUR 397

ERMAP antibody
31940-100ul	SAB	100ul	EUR 252

ERMAP antibody
31940-50ul	SAB	50ul	EUR 187

ERMAP antibody
10R-4029	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal ERMAP antibody

ERMAP Antibody
39845-100ul	SAB	100ul	EUR 390

ERMAP antibody
70R-7347	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ERMAP antibody

ERMAP antibody
70R-7360	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ERMAP antibody

anti- ERMAP antibody
FNab02850	FN Test	100µg	EUR 585
Immunogen: erythroblast membrane-associated protein(Scianna blood group) Uniprot ID: Q96PL5 Gene ID: 114625 Research Area: Immunology
Description: Antibody raised against ERMAP

Anti-ERMAP antibody
PAab02850	Lifescience Market	100 ug	EUR 412

Anti-ERMAP antibody
STJ112457	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene.

Anti-ERMAP antibody
STJ192371	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ERMAP

ERMAP siRNA
20-abx915648	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ERMAP siRNA
20-abx915649	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ERMAP
YF-PA21865	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to ERMAP

anti-ERMAP
YF-PA21866	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ERMAP

anti-ERMAP
YF-PA21867	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to ERMAP

anti-ERMAP
YF-PA21868	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to ERMAP

anti-ERMAP
YF-PA26813	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to ERMAP

ERMAP Blocking Peptide
33R-8176	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERMAP antibody, catalog no. 70R-7347

ERMAP Blocking Peptide
33R-6968	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ERMAP antibody, catalog no. 70R-7360

ERMAP cloning plasmid
CSB-CL853480HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1428 Sequence: ATGGAGATGGCGAGTTCTGCTGGCTCCTGGCTCTCTGGCTGCCTCATCCCTCTCGTCTTCCTCCGGCTGTCTGTGCATGTGTCAGGCCACGCAGGGGATGCCGGCAAGTTCCACGTGGCCCTACTAGGGGGCACAGCCGAGCTGCTCTGCCCTCTCTCCCTCTGGCCCGGGACGG Show more
Description: A cloning plasmid for the ERMAP gene.

anti-ERMAP (6F8)
LF-MA10101	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ERMAP

ERMAP ELISA KIT|Human
EF009442	Lifescience Market	96 Tests	EUR 689

Human ERMAP shRNA Plasmid
20-abx964360	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ERMAP shRNA Plasmid
20-abx973817	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ERMAP Recombinant Protein (Human)
RP038803	ABM	100 ug	Ask for price

ERMAP Recombinant Protein (Mouse)
RP132197	ABM	100 ug	Ask for price

Monoclonal ERMAP Antibody (monoclonal) (M01), Clone: 6F8
APR15870G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ERMAP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 6F8. This antibody is applicable in WB, E

ERMAP ORF Vector (Human) (pORF)
ORF012935	ABM	1.0 ug DNA	EUR 354

Ermap ORF Vector (Mouse) (pORF)
ORF044067	ABM	1.0 ug DNA	EUR 506

ERMAP sgRNA CRISPR Lentivector set (Human)
K0693301	ABM	3 x 1.0 ug	EUR 339

Ermap sgRNA CRISPR Lentivector set (Mouse)
K3499001	ABM	3 x 1.0 ug	EUR 339

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody
20-abx125825	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody
abx037092-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody
abx030390-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody
abx030390-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Erythroblast Membrane Associated Protein (Scianna Blood Group) (ERMAP) Antibody
abx232850-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

ERMAP sgRNA CRISPR Lentivector (Human) (Target 1)
K0693302	ABM	1.0 ug DNA	EUR 154

ERMAP sgRNA CRISPR Lentivector (Human) (Target 2)
K0693303	ABM	1.0 ug DNA	EUR 154

ERMAP sgRNA CRISPR Lentivector (Human) (Target 3)
K0693304	ABM	1.0 ug DNA	EUR 154

Ermap sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3499002	ABM	1.0 ug DNA	EUR 154

Ermap sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3499003	ABM	1.0 ug DNA	EUR 154

Ermap sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3499004	ABM	1.0 ug DNA	EUR 154

ERMAP Protein Vector (Mouse) (pPB-C-His)
PV176266	ABM	500 ng	EUR 603

ERMAP Protein Vector (Mouse) (pPB-N-His)
PV176267	ABM	500 ng	EUR 603

ERMAP Protein Vector (Mouse) (pPM-C-HA)
PV176268	ABM	500 ng	EUR 603

ERMAP Protein Vector (Mouse) (pPM-C-His)
PV176269	ABM	500 ng	EUR 603

ERMAP Protein Vector (Human) (pPB-C-His)
PV051737	ABM	500 ng	EUR 481

ERMAP Protein Vector (Human) (pPB-N-His)
PV051738	ABM	500 ng	EUR 481

ERMAP Protein Vector (Human) (pPM-C-HA)
PV051739	ABM	500 ng	EUR 481

ERMAP Protein Vector (Human) (pPM-C-His)
PV051740	ABM	500 ng	EUR 481

Ermap 3'UTR GFP Stable Cell Line
TU155935	ABM	1.0 ml	Ask for price

Ermap 3'UTR Luciferase Stable Cell Line
TU105935	ABM	1.0 ml	Ask for price

Ermap 3'UTR Luciferase Stable Cell Line
TU204090	ABM	1.0 ml	Ask for price

Ermap 3'UTR GFP Stable Cell Line
TU254090	ABM	1.0 ml	Ask for price

ERMAP 3'UTR GFP Stable Cell Line
TU057025	ABM	1.0 ml	EUR 1521

ERMAP 3'UTR Luciferase Stable Cell Line
TU007025	ABM	1.0 ml	EUR 1521

Human Erythroid membrane- associated protein, ERMAP ELISA KIT
ELI-08316h	Lifescience Market	96 Tests	EUR 824

Human Erythroid Membrane-Associated Protein (ERMAP) ELISA Kit
abx387188-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Erythroid Membrane-Associated Protein (ERMAP) ELISA Kit
abx389195-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Erythroid membrane- associated protein, Ermap ELISA KIT
ELI-32770m	Lifescience Market	96 Tests	EUR 865

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

ERMAP Rabbit Polyclonal Antibody