ESAM Rabbit Polyclonal Antibody
 ESAM Polyclonal Antibody |
|
ABP58502-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ESAM protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein |
ESAM Polyclonal Antibody |
|
ABP58502-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ESAM protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ESAM from Human, Mouse, Rat. This ESAM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESAM protein |
ESAM Polyclonal Antibody |
|
A55335 |
EpiGentek |
100 ยตg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
ESAM Polyclonal Antibody |
|
ES11142-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ESAM Polyclonal Antibody |
|
ES11142-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ESAM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ESAM Rabbit pAb |
|
A12210-100ul |
Abclonal |
100 ul |
EUR 308 |
ESAM Rabbit pAb |
|
A12210-200ul |
Abclonal |
200 ul |
EUR 459 |
ESAM Rabbit pAb |
|
A12210-20ul |
Abclonal |
20 ul |
EUR 183 |
ESAM Rabbit pAb |
|
A12210-50ul |
Abclonal |
50 ul |
EUR 223 |
 ELISA Kit) Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit |
|
DLR-ESAM-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit |
|
DLR-ESAM-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Adhesion Molecule (ESAM) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit |
|
RDR-ESAM-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit |
|
RDR-ESAM-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit |
|
RD-ESAM-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Endothelial Cell Adhesion Molecule (ESAM) ELISA Kit |
|
RD-ESAM-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 ESAM Polyclonal Conjugated Antibody |
|
C27645 |
SAB |
100ul |
EUR 397 |
 ESAM antibody |
|
70R-17149 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal ESAM antibody |
 ESAM Antibody |
|
1-CSB-PA850258LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ESAM Antibody |
|
1-CSB-PA007818GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20รขโฦ, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 ESAM Polyclonal Antibody, HRP Conjugated |
|
A55336 |
EpiGentek |
100 ยตg |
EUR 570.55 |
|
Description: fast delivery possible |
 ESAM Polyclonal Antibody, FITC Conjugated |
|
A55337 |
EpiGentek |
100 ยตg |
EUR 570.55 |
|
Description: reagents widely cited |
 ESAM Polyclonal Antibody, Biotin Conjugated |
|
A55338 |
EpiGentek |
100 ยตg |
EUR 570.55 |
|
Description: Ask the seller for details |
 anti- ESAM antibody |
|
FNab02860 |
FN Test |
100ยตg |
EUR 548.75 |
- Immunogen: endothelial cell adhesion molecule
- Uniprot ID: Q96AP7
- Gene ID: 90952
- Research Area: Immunology, Cardiovascular
|
|
Description: Antibody raised against ESAM |
 Anti-ESAM antibody |
|
STJ192300 |
St John's Laboratory |
200 ยตl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ESAM |
 ESAM siRNA |
|
20-abx901776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ESAM siRNA |
|
20-abx915678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ESAM siRNA |
|
20-abx915679 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ESAM |
|
YF-PA21677 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ESAM |
anti-ESAM |
|
YF-PA21678 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to ESAM |
anti-ESAM |
|
YF-PA21679 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to ESAM |
 ESAM Antibody, HRP conjugated |
|
1-CSB-PA850258LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 ESAM Antibody, FITC conjugated |
|
1-CSB-PA850258LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 ESAM Antibody, Biotin conjugated |
|
1-CSB-PA850258LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESAM. Recognizes ESAM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Polyclonal Antibody (Human)) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human) |
|
4-PAE536Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM) |
 Polyclonal Antibody (Mouse)) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse) |
|
4-PAE536Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM) |
 Polyclonal Antibody (Rat)) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat) |
|
4-PAE536Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM) |
 ESAM cloning plasmid |
|
CSB-CL850258HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 รยผg plasmid + 200รยผl Glycerol
- Length: 1173
- Sequence: atgatttccctcccggggcccctggtgaccaacttgctgcggtttttgttcctggggctgagtgccctcgcgcccccctcgcgggcccagctgcaactgcacttgcccgccaaccggttgcaggcggtggagggaggggaagtggtgcttccagcgtggtacaccttgcacgggg
- Show more
|
|
Description: A cloning plasmid for the ESAM gene. |
) Anti-ESAM (1G8) |
|
YF-MA19632 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ESAM |
) Anti-ESAM (1E4) |
|
YF-MA19633 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ESAM |
 Polyclonal Antibody (Human), APC) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), APC |
|
4-PAE536Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), Biotinylated |
|
4-PAE536Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), Cy3 |
|
4-PAE536Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), FITC |
|
4-PAE536Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), HRP |
|
4-PAE536Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), PE |
|
4-PAE536Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE. |
 Polyclonal Antibody (Mouse), APC) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), APC |
|
4-PAE536Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse), Biotinylated) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAE536Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse), Cy3) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAE536Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse), FITC) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), FITC |
|
4-PAE536Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse), HRP) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), HRP |
|
4-PAE536Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse), PE) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), PE |
|
4-PAE536Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE. |
 Polyclonal Antibody (Rat), APC) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), APC |
|
4-PAE536Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC. |
 Polyclonal Antibody (Rat), Biotinylated) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), Biotinylated |
|
4-PAE536Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Rat), Cy3) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), Cy3 |
|
4-PAE536Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Rat), FITC) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), FITC |
|
4-PAE536Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with FITC. |
 Polyclonal Antibody (Rat), HRP) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), HRP |
|
4-PAE536Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with HRP. |
 Polyclonal Antibody (Rat), PE) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), PE |
|
4-PAE536Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with PE. |
 Antibody) Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx103577 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx103578 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx112290 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx125826 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx130223 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx109755 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
20-abx172231 |
Abbexa |
|
|
|
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
abx030442-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
abx030442-80l |
Abbexa |
80 ยตl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody |
|
abx232860-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAE536Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Leu31~Val390)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC-Cy7. |
 Polyclonal Antibody (Mouse), APC-Cy7) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAE536Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Ala29~Ser248)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC-Cy7. |
 Polyclonal Antibody (Rat), APC-Cy7) Endothelial Cell Adhesion Molecule (ESAM) Polyclonal Antibody (Rat), APC-Cy7 |
|
4-PAE536Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESAM (Met31~Ala251)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Adhesion Molecule (ESAM). This antibody is labeled with APC-Cy7. |
 Rat ESAM shRNA Plasmid |
|
20-abx989060 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse ESAM shRNA Plasmid |
|
20-abx976955 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ESAM shRNA Plasmid |
|
20-abx963997 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ESAM Recombinant Protein (Human) |
|
RP010933 |
ABM |
100 ug |
Ask for price |
) ESAM Recombinant Protein (Rat) |
|
RP199946 |
ABM |
100 ug |
Ask for price |
) ESAM Recombinant Protein (Mouse) |
|
RP132233 |
ABM |
100 ug |
Ask for price |
 Antibody (Biotin)) Endothelial Cell Adhesion Molecule (ESAM) Antibody (Biotin) |
|
20-abx105379 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Endothelial Cell Adhesion Molecule (ESAM) Antibody (FITC) |
|
20-abx106798 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Endothelial Cell Adhesion Molecule (ESAM) Antibody (HRP) |
|
20-abx108217 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody (Biotin) |
|
20-abx272358 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody (Biotin) |
|
20-abx272902 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody (FITC) |
|
20-abx273589 |
Abbexa |
-
EUR 481.00
-
EUR 244.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Endothelial Cell Adhesion Molecule (ESAM) Antibody (FITC) |
|
20-abx273883 |
Abbexa |
-
EUR 495.00
-
EUR 258.00
-
EUR 1455.00
-
EUR 676.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 (pORF)) Esam ORF Vector (Rat) (pORF) |
|
ORF066650 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ESAM ORF Vector (Human) (pORF) |
|
ORF003645 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Esam ORF Vector (Mouse) (pORF) |
|
ORF044079 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD00940)) ESAM ELISA Kit (Human) (OKCD00940) |
|
OKCD00940 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Can mediate aggregation most likely through a homophilic molecular interaction.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL |
 (OKCA01663)) ESAM ELISA Kit (Mouse) (OKCA01663) |
|
OKCA01663 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: Can mediate aggregation most likely through a homophilic molecular interaction.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL |
) ESAM sgRNA CRISPR Lentivector set (Human) |
|
K0695901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Esam sgRNA CRISPR Lentivector set (Rat) |
|
K7449501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Esam sgRNA CRISPR Lentivector set (Mouse) |
|
K3502001 |
ABM |
3 x 1.0 ug |
EUR 339 |
ESAM Rabbit Polyclonal Antibody
