셀타젠 Genetic Genotyping

EXTL3 Rabbit Polyclonal Antibody

EXTL3 Polyclonal Antibody

ABP58509-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EXTL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EXTL3 from Human, Mouse. This EXTL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EXTL3 protein

EXTL3 Polyclonal Antibody

ABP58509-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EXTL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EXTL3 from Human, Mouse. This EXTL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EXTL3 protein

EXTL3 Polyclonal Antibody

A51669 100 µg
EUR 570.55
Description: fast delivery possible

EXTL3 Rabbit pAb

A3857-100ul 100 ul
EUR 308

EXTL3 Rabbit pAb

A3857-200ul 200 ul
EUR 459

EXTL3 Rabbit pAb

A3857-20ul 20 ul
EUR 183

EXTL3 Rabbit pAb

A3857-50ul 50 ul
EUR 223

EXTL3 Antibody

36453-100ul 100ul
EUR 252

EXTL3 antibody

70R-17181 50 ul
EUR 435
Description: Rabbit polyclonal EXTL3 antibody

EXTL3 antibody

70R-15308 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody

EXTL3 Antibody

DF12993 200ul
EUR 304
Description: EXTL3 Antibody detects endogenous levels of EXTL3.

EXTL3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXTL3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

EXTL3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

EXTL3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

EXTL3 Polyclonal Antibody, HRP Conjugated

A51670 100 µg
EUR 570.55
Description: reagents widely cited

EXTL3 Polyclonal Antibody, FITC Conjugated

A51671 100 µg
EUR 570.55
Description: Ask the seller for details

EXTL3 Polyclonal Antibody, Biotin Conjugated

A51672 100 µg
EUR 570.55
Description: The best epigenetics products

EXTL3 Conjugated Antibody

C36453 100ul
EUR 397

anti- EXTL3 antibody

FNab02912 100µg
EUR 505.25
  • Immunogen: exostoses(multiple)-like 3
  • Uniprot ID: O43909
  • Gene ID: 2137
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against EXTL3

EXTL3 antibody (HRP)

60R-1754 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody (HRP)

EXTL3 antibody (FITC)

60R-1755 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody (FITC)

EXTL3 antibody (biotin)

60R-1756 100 ug
EUR 327
Description: Rabbit polyclonal EXTL3 antibody (biotin)

Anti-EXTL3 antibody

PAab02912 100 ug
EUR 355

Anti-EXTL3 antibody

STJ23590 100 µl
EUR 277
Description: This gene encodes a single-pass membrane protein which functions as a glycosyltransferase. The encoded protein catalyzes the transfer of N-acetylglucosamine to glycosaminoglycan chains. This reaction is important in heparin and heparan sulfate synthesis. Alternative splicing results in the multiple transcript variants.

Anti-EXTL3 antibody

STJ192125 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EXTL3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EXTL3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EXTL3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EXTL3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EXTL3. Recognizes EXTL3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

EXTL3 cloning plasmid

CSB-CL007905HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2760
  • Sequence: atgacaggctataccatgctgcggaatgggggcgcggggaacggaggtcagacctgcatgctgcgctggtccaaccgcatccgcctcacgtggctcagcttcacgctctttgtcatcctggtcttcttcccgctcatcgcccactattacctcaccactctggatgaggctgatg
  • Show more
Description: A cloning plasmid for the EXTL3 gene.

EXTL3 Blocking Peptide

DF12993-BP 1mg
EUR 195


EF009489 96 Tests
EUR 689

Human EXTL3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

abx036241-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

abx034206-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

abx034206-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody

abx232912-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody Pair

abx117473-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Exostoses (Multiple)-Like 3 (EXTL3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EXTL3 ORF Vector (Human) (pORF)

ORF003697 1.0 ug DNA
EUR 95

Extl3 ORF Vector (Rat) (pORF)

ORF066717 1.0 ug DNA
EUR 506

Extl3 ORF Vector (Mouse) (pORF)

ORF044189 1.0 ug DNA
EUR 506

Extl3 sgRNA CRISPR Lentivector set (Mouse)

K4673401 3 x 1.0 ug
EUR 339

EXTL3 sgRNA CRISPR Lentivector set (Human)

K0705201 3 x 1.0 ug
EUR 339

Extl3 sgRNA CRISPR Lentivector set (Rat)

K6906801 3 x 1.0 ug
EUR 339

Human Exostosin- like 3, EXTL3 ELISA KIT

ELI-20576h 96 Tests
EUR 824

Mouse Exostosin- like 3, Extl3 ELISA KIT

ELI-32847m 96 Tests
EUR 865

Human Exostosin-Like 3 (EXTL3) ELISA Kit

abx387231-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Exostosin-Like 3 (EXTL3) ELISA Kit

abx389227-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Extl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4673402 1.0 ug DNA
EUR 154

Extl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4673403 1.0 ug DNA
EUR 154

EXTL3 Rabbit Polyclonal Antibody