셀타젠 Genetic Genotyping

EZH2 Rabbit Polyclonal Antibody

EZH2 Polyclonal Antibody

ABP58511-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EZH2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EZH2 from Human, Mouse. This EZH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EZH2 protein

EZH2 Polyclonal Antibody

ABP58511-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EZH2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EZH2 from Human, Mouse. This EZH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EZH2 protein

EZH2 Polyclonal Antibody

ABP58511-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EZH2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EZH2 from Human, Mouse. This EZH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EZH2 protein

EZH2 Polyclonal Antibody

ES11147-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EZH2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EZH2 Polyclonal Antibody

ES11147-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EZH2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal EzH2 polyclonal antibody

APR00373G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EzH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EZH2 polyclonal antibody

APR00436G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EZH2 polyclonal antibody

APR00439G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 polyclonal . This antibody is tested and proven to work in the following applications:

EZH2 Rabbit pAb

A11085-100ul 100 ul
EUR 308

EZH2 Rabbit pAb

A11085-200ul 200 ul
EUR 459

EZH2 Rabbit pAb

A11085-20ul 20 ul
EUR 183

EZH2 Rabbit pAb

A11085-50ul 50 ul
EUR 223

EZH2 Rabbit pAb

A13867-100ul 100 ul
EUR 308

EZH2 Rabbit pAb

A13867-200ul 200 ul
EUR 459

EZH2 Rabbit pAb

A13867-20ul 20 ul
EUR 183

EZH2 Rabbit pAb

A13867-50ul 50 ul
EUR 223

EZH2 Rabbit pAb

A5743-100ul 100 ul
EUR 308

EZH2 Rabbit pAb

A5743-200ul 200 ul
EUR 459

EZH2 Rabbit pAb

A5743-20ul 20 ul
EUR 183

EZH2 Rabbit pAb

A5743-50ul 50 ul
EUR 223

EZH2 Rabbit pAb

A5535-100ul 100 ul
EUR 308

EZH2 Rabbit pAb

A5535-200ul 200 ul
EUR 459

EZH2 Rabbit pAb

A5535-20ul 20 ul Ask for price

EZH2 Rabbit pAb

A5535-50ul 50 ul Ask for price

EZH2 Rabbit pAb

A16846-100ul 100 ul
EUR 308

EZH2 Rabbit pAb

A16846-200ul 200 ul
EUR 459

EZH2 Rabbit pAb

A16846-20ul 20 ul
EUR 183

EZH2 Rabbit pAb

A16846-50ul 50 ul
EUR 223

Polyclonal EZH2 Antibody (Center)

APR05046G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 (Center). This antibody is tested and proven to work in the following applications:

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

DLR-EZH2-Hu-48T 48T
EUR 517
  • Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

DLR-EZH2-Hu-96T 96T
EUR 673
  • Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RDR-EZH2-Hu-48Tests 48 Tests
EUR 544

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RDR-EZH2-Hu-96Tests 96 Tests
EUR 756

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RD-EZH2-Hu-48Tests 48 Tests
EUR 521

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit

RD-EZH2-Hu-96Tests 96 Tests
EUR 723

KMT6 / EZH2 Rabbit mAb

A19577-100ul 100 ul
EUR 410

KMT6 / EZH2 Rabbit mAb

A19577-200ul 200 ul
EUR 571

KMT6 / EZH2 Rabbit mAb

A19577-20ul 20 ul
EUR 221

KMT6 / EZH2 Rabbit mAb

A19577-50ul 50 ul
EUR 287

Polyclonal EZH2 Antibody (N-Terminus)

APR02877G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 (N-Terminus). This antibody is tested and proven to work in the following applications:

EZH2 Antibody

25291-100ul 100ul
EUR 390

EZH2 antibody

20R-1200 100 ug
EUR 377
Description: Rabbit polyclonal EZH2 antibody

EZH2 antibody

70R-17185 50 ul
EUR 435
Description: Rabbit polyclonal EZH2 antibody

EZH2 antibody

70R-11708 100 ug
EUR 403
Description: Rabbit polyclonal EZH2 antibody

EZH2 Antibody

33009-100ul 100ul
EUR 252

EZH2 Antibody

EUR 316

EZH2 Antibody

EUR 146

EZH2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

EZH2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

EZH2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

EZH2 Antibody

AF5150 200ul
EUR 304
Description: EZH2 Antibody detects endogenous levels of total EZH2.

EZH2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Ezh2 Antibody

AF7900 200ul
EUR 376
Description: Ezh2 Antibody detects endogenous levels of Ezh2.

Ezh2 Antibody

AF7901 200ul
EUR 376
Description: Ezh2 Antibody detects endogenous levels of Ezh2.

EZH2 Antibody

ABF5150 100 ug
EUR 438

Anti-KMT6 / EZH2 Rabbit Monoclonal Antibody

M00050 100ug/vial
EUR 397
Description: Rabbit Monoclonal KMT6 / EZH2 Antibody. Validated in WB and tested in Human.

Anti-KMT6 / EZH2 Rabbit Monoclonal Antibody

M00050-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal KMT6 / EZH2 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human.

EZH2 (Phospho-Thr487) Polyclonal Conjugated Antibody

C12820 100ul
EUR 397

Ezh2 (Phospho-Thr487) Polyclonal Conjugated Antibody

C12866 100ul
EUR 397

Ezh2 (Phospho-Ser366) Polyclonal Conjugated Antibody

C12867 100ul
EUR 397

Ezh2 (Phospho-Thr367) Polyclonal Conjugated Antibody

C12868 100ul
EUR 397

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx025197-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx025197-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx215269-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx224132-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx031609-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx031609-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx340102-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody

abx232918-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

KMT6/EZH2 Antibody

49267-100ul 100ul
EUR 333

KMT6/EZH2 Antibody

49267-50ul 50ul
EUR 239

anti- EZH2 antibody

FNab10174 100µg
EUR 505.25
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: Histone-lysine N-methyltransferase EZH2
  • Uniprot ID: Q15910
  • Gene ID: 2146
Description: Antibody raised against EZH2

anti- EZH2 antibody

FNab02918 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:4000
  • IP: 1:500-1:3000
  • IF: 1:20-1:200
  • Immunogen: enhancer of zeste homolog 2(Drosophila)
  • Uniprot ID: Q15910
  • Gene ID: 2146
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against EZH2

Anti-EZH2 antibody

PAab02918 100 ug
EUR 386

Anti-EZH2 antibody

STJ11100918 100 µl
EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody

STJ27486 100 µl
EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody

STJ112944 100 µl
EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody

STJ115806 100 µl
EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody

STJ119217 100 µl
EUR 277

Anti-EZH2 antibody

STJ160100 1 mL C
EUR 1523

Anti-EZH2 antibody

STJ180357 0.1 ml
EUR 255

Anti-EZH2 antibody

STJ192305 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EZH2

EZH2 Protein

E24031 20 µg
EUR 809.8
Description: fast delivery possible


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EZH2 (Phospho-Thr487) Antibody

12820-100ul 100ul
EUR 252

EZH2 (Phospho-Thr487) Antibody

12820-50ul 50ul
EUR 187

Ezh2 (Phospho-Thr487) Antibody

12866-100ul 100ul
EUR 252

Ezh2 (Phospho-Thr487) Antibody

12866-50ul 50ul
EUR 187

Ezh2 (Phospho-Ser366) Antibody

12867-100ul 100ul
EUR 252

Ezh2 (Phospho-Ser366) Antibody

12867-50ul 50ul
EUR 187

Ezh2 (Phospho-Thr367) Antibody

12868-100ul 100ul
EUR 252

Ezh2 (Phospho-Thr367) Antibody

12868-50ul 50ul
EUR 187

Anti-KMT6/EZH2 Antibody

A00050-1 100ug/vial
EUR 294

EZH2 (phospho T487) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

KMT6/EZH2 Conjugated Antibody

C49267 100ul
EUR 397

Anti-EZH2/Kmt6 Antibody

CI1042 50ug/50ul
EUR 491
Description: Rabbit Polyclonal EZH2/Kmt6 Antibody. Validated in ChIP and tested in Human, Mouse.

Anti-EZH2 Antibody (Monoclonal)

CI1145 50ug/50ul
EUR 491
Description: Mouse Monoclonal EZH2 Antibody (Monoclonal). Validated in ChIP, ChIP-qPCR and tested in Human.

Phospho-Ezh2 (Thr487) Antibody

AF7400 200ul
EUR 376
Description: Phospho-Ezh2 (Thr487) Antibody detects endogenous levels of Ezh2 only when phosphorylated at Thr487.

Phospho-EZH2(Ser475) Antibody

AF8604 200ul
EUR 376
Description: Phospho-EZH2(S475) Antibody detects endogenous levels of EZH2 only when phosphorylated at S475.

Phospho-EZH2(Thr369) Antibody

AF8605 200ul
EUR 376
Description: Phospho-EZH2(T369) Antibody detects endogenous levels of EZH2 only when phosphorylated at T369.

Phospho-EZH2(Thr367) Antibody

AF8606 200ul
EUR 376
Description: Phospho-EZH2(T367) Antibody detects endogenous levels of EZH2 only when phosphorylated at T367.

Phospho-EZH2(Ser476) Antibody

AF8613 200ul
EUR 376
Description: Phospho-EZH2(S476)Antibody detects endogenous levels of EZH2 only when phosphorylated at S476.

Monoclonal EZH2 monoclonal antibody

AMM00030G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human EZH2 monoclonal. The antibodies are raised in Mouse.

EZH2 (phospho T487) Antibody

ABD7704 100 ug
EUR 438

Anti-KMT6 / EZH2 Antibody

STJ500978 100 µg
EUR 476

Rabbit Anti-Human EZH2 monoclonal antibody, clone KK190-0

CABT-L838 100 ul
EUR 777

EZH2 Inhibitor, EPZ005687

EUR 479

EZH2 Inhibitor, EPZ005687

EUR 175

EZH2 Blocking Peptide

33R-4398 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EZH2 antibody, catalog no. 20R-1200

EZH2 Blocking Peptide

33R-10679 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EZH2 antibody, catalog no. 70R-11708

EZH2 Blocking Peptide

EUR 153

EZH2 Blocking Peptide

AF5150-BP 1mg
EUR 195

EZH2 cloning plasmid

CSB-CL613606HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2256
  • Sequence: atgggccagactgggaagaaatctgagaagggaccagtttgttggcggaagcgtgtaaaatcagagtacatgcgactgagacagctcaagaggttcagacgagctgatgaagtaaagagtatgtttagttccaatcgtcagaaaattttggaaagaacggaaatcttaaaccaag
  • Show more
Description: A cloning plasmid for the EZH2 gene.

Ezh2 Blocking Peptide

AF7900-BP 1mg
EUR 195

Ezh2 Blocking Peptide

AF7901-BP 1mg
EUR 195


PVT18065 2 ug
EUR 258

Anti-EZH2 (1D11)

YF-MA20323 100 ug
EUR 363
Description: Mouse monoclonal to EZH2

anti-KMT6 / EZH2

YF-PA11650 50 ug
EUR 363
Description: Mouse polyclonal to KMT6 / EZH2

anti-KMT6 / EZH2

YF-PA11651 100 ug
EUR 403
Description: Rabbit polyclonal to KMT6 / EZH2

Ezh2 (Phospho-Ser363/366) Antibody

13246-100ul 100ul
EUR 252

Ezh2 (Phospho-Ser363/366) Antibody

13246-50ul 50ul
EUR 187

Phospho-Ezh2 (Ser363/366) Antibody

AF7401 200ul
EUR 376
Description: Phospho-Ezh2 (Ser363/366) Antibody detects endogenous levels of Ezh2 only when phosphorylated at Ser363/366.

Monoclonal EZH2 Antibody, Clone: 144CT2.1.1.5

AMM02337G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human EZH2. The antibodies are raised in Mouse and are from clone 144CT2.1.1.5. This antibody is applicable in IHC-P, IF, WB, E

Monoclonal EZH2 Antibody, Clone: 6G4F4

AMM03023G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human EZH2. The antibodies are raised in Mouse and are from clone 6G4F4. This antibody is applicable in WB and IHC, FC, ICC, E

Anti-KMT6 / EZH2 Antibody BIOTIN

STJ500979 100 µg
EUR 586

Anti-KMT6 / EZH2 Antibody FITC

STJ500980 100 µg
EUR 586

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2)

Human Histone-Lysine N-Methyltransferase EZH2 (EZH2) ELISA Kit

abx257268-96tests 96 tests
EUR 652
  • Shipped within 20 working days.

Human EZH2/ Histone-lysine N-methyltransferase EZH2 ELISA Kit

E0829Hu 1 Kit
EUR 605

Human Histone- lysine N- methyltransferase EZH2, EZH2 ELISA KIT

ELI-31370h 96 Tests
EUR 824

Human Histone-lysine N-methyltransferase EZH2(EZH2) ELISA kit

CSB-EL007913HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Histone-lysine N-methyltransferase EZH2 (EZH2) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Histone-lysine N-methyltransferase EZH2(EZH2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Histone-lysine N-methyltransferase EZH2(EZH2) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Histone-Lysine N-Methyltransferase EZH2 (EZH2) ELISA Kit

abx522587-96tests 96 tests
EUR 668
  • Shipped within 1-2 months.

Mouse Histone- lysine N- methyltransferase EZH2, Ezh2 ELISA KIT

ELI-47556m 96 Tests
EUR 865

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with APC.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with Biotin.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with Cy3.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with FITC.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with HRP.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with PE.

Ezh2 (Phospho-Ser363/366) Conjugated Antibody

C13246 100ul
EUR 397


EF007337 96 Tests
EUR 689

Mouse EZH2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EZH2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pcDNA3.1-Flag-EZH2 Plasmid

PVTB00699-2a 2 ug
EUR 356

EZH2 Recombinant Protein (Human)

RP011104 100 ug Ask for price

EZH2 Recombinant Protein (Rat)

RP200159 100 ug Ask for price

EZH2 Recombinant Protein (Mouse)

RP132590 100 ug Ask for price

EZH2 Recombinant Protein (Mouse)

RP132593 100 ug Ask for price

Anti-KMT6 / EZH2 (2C3)

YF-MA10308 100 ug
EUR 363
Description: Mouse monoclonal to KMT6 / EZH2

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: EZH2 (Glu51~Phe285)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with APC-Cy7.

Enhancer Of Zeste Homolog 2 (EZH2) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Enhancer of Zeste Homolog 2 (EZH2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospho-Ezh2 (Thr487) Blocking Peptide

AF7400-BP 1mg
EUR 195

Phospho-EZH2(Ser475) Blocking Peptide

AF8604-BP 1mg
EUR 195

Phospho-EZH2(Thr369) Blocking Peptide

AF8605-BP 1mg
EUR 195

Phospho-EZH2(Thr367) Blocking Peptide

AF8606-BP 1mg
EUR 195

Phospho-EZH2(Ser476) Blocking Peptide

AF8613-BP 1mg
EUR 195

Ezh2 ORF Vector (Rat) (pORF)

ORF066721 1.0 ug DNA
EUR 506

EZH2 ORF Vector (Human) (pORF)

ORF003702 1.0 ug DNA
EUR 95

Ezh2 ORF Vector (Mouse) (pORF)

ORF044198 1.0 ug DNA
EUR 506

Ezh2 ORF Vector (Mouse) (pORF)

ORF044199 1.0 ug DNA
EUR 95

Mouse Anti-Human EZH2 monoclonal antibody, clone JID681

CABT-L2864-100uL500uL 100 uL, 500 uL
EUR 502

Phospho-Ezh2 (Ser363/366) Blocking Peptide

AF7401-BP 1mg
EUR 195

Ezh2 sgRNA CRISPR Lentivector set (Rat)

K7283401 3 x 1.0 ug
EUR 339

EZH2 sgRNA CRISPR Lentivector set (Human)

K0012701 3 x 1.0 ug
EUR 339

EZH2 sgRNA CRISPR Lentivector set (Mouse)

K3004901 3 x 1.0 ug
EUR 339

Ezh2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7283402 1.0 ug DNA
EUR 154

Ezh2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7283403 1.0 ug DNA
EUR 154

Ezh2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7283404 1.0 ug DNA
EUR 154

EZH2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0012702 1.0 ug DNA
EUR 154

EZH2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0012703 1.0 ug DNA
EUR 154

EZH2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0012704 1.0 ug DNA
EUR 154

EZH2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3004902 1.0 ug DNA
EUR 154

EZH2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3004903 1.0 ug DNA
EUR 154

EZH2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3004904 1.0 ug DNA
EUR 154

EZH2 Protein Vector (Mouse) (pPB-C-His)

PV176790 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPB-N-His)

PV176791 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPM-C-HA)

PV176792 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPM-C-His)

PV176793 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPB-C-His)

PV176794 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPB-N-His)

PV176795 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPM-C-HA)

PV176796 500 ng
EUR 1065

EZH2 Protein Vector (Mouse) (pPM-C-His)

PV176797 500 ng
EUR 1065

EZH2 Protein Vector (Rat) (pPB-C-His)

PV266882 500 ng
EUR 1166

EZH2 Protein Vector (Rat) (pPB-N-His)

PV266883 500 ng
EUR 1166

EZH2 Protein Vector (Rat) (pPM-C-HA)

PV266884 500 ng
EUR 1166

EZH2 Protein Vector (Rat) (pPM-C-His)

PV266885 500 ng
EUR 1166

EZH2 Protein Vector (Human) (pPB-C-His)

PV014805 500 ng
EUR 329

EZH2 Protein Vector (Human) (pPB-N-His)

PV014806 500 ng
EUR 329

EZH2 Protein Vector (Human) (pPM-C-HA)

PV014807 500 ng
EUR 329

EZH2 Protein Vector (Human) (pPM-C-His)

PV014808 500 ng
EUR 329

Recombinant Enhancer Of Zeste Homolog 2 (EZH2)

  • EUR 565.92
  • EUR 254.00
  • EUR 1847.20
  • EUR 682.40
  • EUR 1264.80
  • EUR 442.00
  • EUR 4468.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15910
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Enhancer Of Zeste Homolog 2 expressed in: E.coli

Recombinant Enhancer Of Zeste Homolog 2 (EZH2)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15910
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Enhancer Of Zeste Homolog 2 expressed in: E.coli

Ezh2 3'UTR GFP Stable Cell Line

TU156038 1.0 ml Ask for price

Ezh2 3'UTR Luciferase Stable Cell Line

TU106038 1.0 ml Ask for price

Ezh2 3'UTR Luciferase Stable Cell Line

TU204178 1.0 ml Ask for price

Ezh2 3'UTR GFP Stable Cell Line

TU254178 1.0 ml Ask for price

EZH2 3'UTR GFP Stable Cell Line

TU057156 1.0 ml
EUR 1318

EZH2 3'UTR Luciferase Stable Cell Line

TU007156 1.0 ml
EUR 1318

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

EZH2 Rabbit Polyclonal Antibody