EZH2 Rabbit Polyclonal Antibody

EZH2 Polyclonal Antibody
ABP58511-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human EZH2 protein Applications tips:
Description: A polyclonal antibody for detection of EZH2 from Human, Mouse. This EZH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EZH2 protein

EZH2 Polyclonal Antibody
ABP58511-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human EZH2 protein Applications tips:
Description: A polyclonal antibody for detection of EZH2 from Human, Mouse. This EZH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EZH2 protein

EZH2 Polyclonal Antibody
ABP58511-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human EZH2 protein Applications tips:
Description: A polyclonal antibody for detection of EZH2 from Human, Mouse. This EZH2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EZH2 protein

EZH2 Polyclonal Antibody
A-2019	EpiGentek	100 µl	EUR 628.55
Description: The best epigenetics products

EzH2 polyclonal antibody
6838-25	Biovision		EUR 316

Polyclonal EzH2 polyclonal antibody
APR00373G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EzH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EZH2 polyclonal antibody
APR00436G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EZH2 polyclonal antibody
APR00439G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 polyclonal . This antibody is tested and proven to work in the following applications:

EZH2 Rabbit pAb
A11085-100ul	Abclonal	100 ul	EUR 308

EZH2 Rabbit pAb
A11085-200ul	Abclonal	200 ul	EUR 459

EZH2 Rabbit pAb
A11085-20ul	Abclonal	20 ul	EUR 183

EZH2 Rabbit pAb
A11085-50ul	Abclonal	50 ul	EUR 223

EZH2 Rabbit pAb
A5743-100ul	Abclonal	100 ul	EUR 308

EZH2 Rabbit pAb
A5743-200ul	Abclonal	200 ul	EUR 459

EZH2 Rabbit pAb
A5743-20ul	Abclonal	20 ul	EUR 183

EZH2 Rabbit pAb
A5743-50ul	Abclonal	50 ul	EUR 223

EZH2 Rabbit pAb
A5535-100ul	Abclonal	100 ul	EUR 308

EZH2 Rabbit pAb
A5535-200ul	Abclonal	200 ul	EUR 459

EZH2 Rabbit pAb
A5535-20ul	Abclonal	20 ul	Ask for price

EZH2 Rabbit pAb
A5535-50ul	Abclonal	50 ul	Ask for price

EZH2 Rabbit pAb
A13867-100ul	Abclonal	100 ul	EUR 308

EZH2 Rabbit pAb
A13867-200ul	Abclonal	200 ul	EUR 459

EZH2 Rabbit pAb
A13867-20ul	Abclonal	20 ul	EUR 183

EZH2 Rabbit pAb
A13867-50ul	Abclonal	50 ul	EUR 223

EZH2 Rabbit pAb
A16846-100ul	Abclonal	100 ul	EUR 308

EZH2 Rabbit pAb
A16846-200ul	Abclonal	200 ul	EUR 459

EZH2 Rabbit pAb
A16846-20ul	Abclonal	20 ul	EUR 183

EZH2 Rabbit pAb
A16846-50ul	Abclonal	50 ul	EUR 223

Polyclonal EZH2 Antibody (Center)
APR05046G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 (Center). This antibody is tested and proven to work in the following applications:

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
DLR-EZH2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
DLR-EZH2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Enhancer Of Zeste Homolog 2 (EZH2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RD-EZH2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RD-EZH2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RDR-EZH2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Enhancer Of Zeste Homolog 2 (EZH2) ELISA Kit
RDR-EZH2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

KMT6 / EZH2 Rabbit mAb
A19577-100ul	Abclonal	100 ul	EUR 410

KMT6 / EZH2 Rabbit mAb
A19577-200ul	Abclonal	200 ul	EUR 571

KMT6 / EZH2 Rabbit mAb
A19577-20ul	Abclonal	20 ul	EUR 221

KMT6 / EZH2 Rabbit mAb
A19577-50ul	Abclonal	50 ul	EUR 287

Polyclonal EZH2 Antibody (N-Terminus)
APR02877G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 (N-Terminus). This antibody is tested and proven to work in the following applications:

EZH2 Antibody
AF5150	Affbiotech	200ul	EUR 304
Description: EZH2 Antibody detects endogenous levels of total EZH2.

Ezh2 Antibody
AF7900	Affbiotech	200ul	EUR 376
Description: Ezh2 Antibody detects endogenous levels of Ezh2.

Ezh2 Antibody
AF7901	Affbiotech	200ul	EUR 376
Description: Ezh2 Antibody detects endogenous levels of Ezh2.

EZH2 Antibody
ABF5150	Lifescience Market	100 ug	EUR 438

EZH2 Antibody
33009-100ul	SAB	100ul	EUR 252

EZH2 Antibody
3242-100	Biovision		EUR 316

EZH2 Antibody
3242-30T	Biovision		EUR 146

EZH2 Antibody
25291-100ul	SAB	100ul	EUR 390

EZH2 antibody
20R-1200	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal EZH2 antibody

EZH2 antibody
70R-17185	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EZH2 antibody

EZH2 antibody
70R-11708	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal EZH2 antibody

EZH2 Antibody
1-CSB-PA934125	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

EZH2 Antibody
1-CSB-PA007913GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EZH2 Antibody
1-CSB-PA761728	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

EZH2 Antibody
1-CSB-PA613606ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EZH2. Recognizes EZH2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Anti-KMT6 / EZH2 Rabbit Monoclonal Antibody
M00050	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal KMT6 / EZH2 Antibody. Validated in WB and tested in Human.

Anti-KMT6 / EZH2 Rabbit Monoclonal Antibody
M00050-1	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal KMT6 / EZH2 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human.

EZH2 (Phospho-Thr487) Polyclonal Conjugated Antibody
C12820	SAB	100ul	EUR 397

Ezh2 (Phospho-Thr487) Polyclonal Conjugated Antibody
C12866	SAB	100ul	EUR 397

Ezh2 (Phospho-Ser366) Polyclonal Conjugated Antibody
C12867	SAB	100ul	EUR 397

Ezh2 (Phospho-Thr367) Polyclonal Conjugated Antibody
C12868	SAB	100ul	EUR 397

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
20-abx125832	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx025197-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx025197-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
20-abx004238	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx031609-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx031609-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
20-abx322319	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx215269-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx224132-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx340102-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
20-abx225163	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Histone-Lysine N-Methyltransferase EZH2 (EZH2) Antibody
abx232918-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

anti- EZH2 antibody
FNab02918	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:4000 IP: 1:500-1:3000 IF: 1:20-1:200 Immunogen: enhancer of zeste homolog 2(Drosophila) Uniprot ID: Q15910 Gene ID: 2146 Research Area: Epigenetics, Metabolism
Description: Antibody raised against EZH2

anti- EZH2 antibody
FNab10174	FN Test	100µg	EUR 505.25
Recommended dilution: IHC: 1:50-1:500 Immunogen: Histone-lysine N-methyltransferase EZH2 Uniprot ID: Q15910 Gene ID: 2146
Description: Antibody raised against EZH2

KMT6/EZH2 Antibody
49267-100ul	SAB	100ul	EUR 333

KMT6/EZH2 Antibody
49267-50ul	SAB	50ul	EUR 239

Anti-EZH2 antibody
PAab02918	Lifescience Market	100 ug	EUR 386

Anti-EZH2 antibody
STJ11100918	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody
STJ27486	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody
STJ112944	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

Anti-EZH2 antibody
STJ119217	St John's Laboratory	100 µl	EUR 277

Anti-EZH2 antibody
STJ160100	St John's Laboratory	1 mL C	EUR 1523

Anti-EZH2 antibody
STJ180357	St John's Laboratory	0.1 ml	EUR 255

Anti-EZH2 antibody
STJ192305	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to EZH2

Anti-EZH2 antibody
STJ115806	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.

EZH2 Protein
E24031	EpiGentek	20 µg	EUR 809.8
Description: fast delivery possible

EZH2 siRNA
20-abx915857	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EZH2 siRNA
20-abx915858	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Phospho-EZH2(Ser475) Antibody
AF8604	Affbiotech	200ul	EUR 376
Description: Phospho-EZH2(S475) Antibody detects endogenous levels of EZH2 only when phosphorylated at S475.

Phospho-EZH2(Thr369) Antibody
AF8605	Affbiotech	200ul	EUR 376
Description: Phospho-EZH2(T369) Antibody detects endogenous levels of EZH2 only when phosphorylated at T369.

Phospho-EZH2(Thr367) Antibody
AF8606	Affbiotech	200ul	EUR 376
Description: Phospho-EZH2(T367) Antibody detects endogenous levels of EZH2 only when phosphorylated at T367.

Phospho-EZH2(Ser476) Antibody
AF8613	Affbiotech	200ul	EUR 376
Description: Phospho-EZH2（S476）Antibody detects endogenous levels of EZH2 only when phosphorylated at S476.

Monoclonal EZH2 monoclonal antibody
AMM00030G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human EZH2 monoclonal. The antibodies are raised in Mouse.

KMT6/EZH2 Conjugated Antibody
C49267	SAB	100ul	EUR 397

Phospho-Ezh2 (Thr487) Antibody
AF7400	Affbiotech	200ul	EUR 376
Description: Phospho-Ezh2 (Thr487) Antibody detects endogenous levels of Ezh2 only when phosphorylated at Thr487.

EZH2 (phospho T487) Antibody
20-abx215270	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Anti-KMT6/EZH2 Antibody
A00050-1	BosterBio	100ug/vial	EUR 294

EZH2 (phospho T487) Antibody
ABD7704	Lifescience Market	100 ug	EUR 438

EZH2 (Phospho-Thr487) Antibody
12820-100ul	SAB	100ul	EUR 252

EZH2 (Phospho-Thr487) Antibody
12820-50ul	SAB	50ul	EUR 187

Ezh2 (Phospho-Thr487) Antibody
12866-100ul	SAB	100ul	EUR 252

Ezh2 (Phospho-Thr487) Antibody
12866-50ul	SAB	50ul	EUR 187

Ezh2 (Phospho-Ser366) Antibody
12867-100ul	SAB	100ul	EUR 252

Ezh2 (Phospho-Ser366) Antibody
12867-50ul	SAB	50ul	EUR 187

Ezh2 (Phospho-Thr367) Antibody
12868-100ul	SAB	100ul	EUR 252

Ezh2 (Phospho-Thr367) Antibody
12868-50ul	SAB	50ul	EUR 187

Anti-EZH2/Kmt6 Antibody
CI1042	BosterBio	50ug/50ul	EUR 491
Description: Rabbit Polyclonal EZH2/Kmt6 Antibody. Validated in ChIP and tested in Human, Mouse.

Anti-EZH2 Antibody (Monoclonal)
CI1145	BosterBio	50ug/50ul	EUR 491
Description: Mouse Monoclonal EZH2 Antibody (Monoclonal). Validated in ChIP, ChIP-qPCR and tested in Human.

Anti-KMT6 / EZH2 Antibody
STJ500978	St John's Laboratory	100 µg	EUR 476

Rabbit Anti-Human EZH2 monoclonal antibody, clone KK190-0
CABT-L838	Creative Diagnostics	100 ul	EUR 777

EZH2 Blocking Peptide
AF5150-BP	Affbiotech	1mg	EUR 195

Ezh2 Blocking Peptide
AF7900-BP	Affbiotech	1mg	EUR 195

Ezh2 Blocking Peptide
AF7901-BP	Affbiotech	1mg	EUR 195

EZH2 cloning plasmid
CSB-CL613606HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2256 Sequence: atgggccagactgggaagaaatctgagaagggaccagtttgttggcggaagcgtgtaaaatcagagtacatgcgactgagacagctcaagaggttcagacgagctgatgaagtaaagagtatgtttagttccaatcgtcagaaaattttggaaagaacggaaatcttaaaccaag Show more
Description: A cloning plasmid for the EZH2 gene.

EZH2 Blocking Peptide
33R-4398	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EZH2 antibody, catalog no. 20R-1200

EZH2 Blocking Peptide
33R-10679	Fitzgerald	50 ug	EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EZH2 antibody, catalog no. 70R-11708

EZH2 Blocking Peptide
3242BP-50	Biovision		EUR 153

EZH2 Inhibitor, EPZ005687
2364-10	Biovision		EUR 479

EZH2 Inhibitor, EPZ005687
2364-2	Biovision		EUR 175

pCMV-SPORT6-EZH2
PVT18065	Lifescience Market	2 ug	EUR 258

Anti-EZH2 (1D11)
YF-MA20323	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to EZH2

anti-KMT6 / EZH2
YF-PA11650	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to KMT6 / EZH2

anti-KMT6 / EZH2
YF-PA11651	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to KMT6 / EZH2

Monoclonal EZH2 Antibody, Clone: 144CT2.1.1.5
AMM02337G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human EZH2. The antibodies are raised in Mouse and are from clone 144CT2.1.1.5. This antibody is applicable in IHC-P, IF, WB, E

Monoclonal EZH2 Antibody, Clone: 6G4F4
AMM03023G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human EZH2. The antibodies are raised in Mouse and are from clone 6G4F4. This antibody is applicable in WB and IHC, FC, ICC, E

Phospho-Ezh2 (Ser363/366) Antibody
AF7401	Affbiotech	200ul	EUR 376
Description: Phospho-Ezh2 (Ser363/366) Antibody detects endogenous levels of Ezh2 only when phosphorylated at Ser363/366.

Ezh2 (Phospho-Ser363/366) Antibody
13246-100ul	SAB	100ul	EUR 252

Ezh2 (Phospho-Ser363/366) Antibody
13246-50ul	SAB	50ul	EUR 187

Anti-KMT6 / EZH2 Antibody BIOTIN
STJ500979	St John's Laboratory	100 µg	EUR 586

Anti-KMT6 / EZH2 Antibody FITC
STJ500980	St John's Laboratory	100 µg	EUR 586

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human)
4-PAK073Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2)

Mouse Histone-Lysine N-Methyltransferase EZH2 (EZH2) ELISA Kit
abx522587-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-2 months.

Human EZH2/ Histone-lysine N-methyltransferase EZH2 ELISA Kit
E0829Hu	Sunlong	1 Kit	EUR 605

Mouse Histone- lysine N- methyltransferase EZH2, Ezh2 ELISA KIT
ELI-47556m	Lifescience Market	96 Tests	EUR 865

Human Histone- lysine N- methyltransferase EZH2, EZH2 ELISA KIT
ELI-31370h	Lifescience Market	96 Tests	EUR 824

Human Histone-Lysine N-Methyltransferase EZH2 (EZH2) ELISA Kit
abx257268-96tests	Abbexa	96 tests	EUR 652
Shipped within 20 working days.

Human Histone-lysine N-methyltransferase EZH2(EZH2) ELISA kit
CSB-EL007913HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Histone-lysine N-methyltransferase EZH2 (EZH2) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Histone-lysine N-methyltransferase EZH2(EZH2) ELISA kit
1-CSB-EL007913HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Histone-lysine N-methyltransferase EZH2(EZH2) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), APC
4-PAK073Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with APC.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), Biotinylated
4-PAK073Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with Biotin.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), Cy3
4-PAK073Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with Cy3.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), FITC
4-PAK073Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with FITC.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), HRP
4-PAK073Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with HRP.

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), PE
4-PAK073Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with PE.

Ezh2 (Phospho-Ser363/366) Conjugated Antibody
C13246	SAB	100ul	EUR 397

EZH2 ELISA KIT|Human
EF007337	Lifescience Market	96 Tests	EUR 689

Human EZH2 shRNA Plasmid
20-abx951491	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EZH2 shRNA Plasmid
20-abx970255	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EZH2 Recombinant Protein (Human)
RP011104	ABM	100 ug	Ask for price

pcDNA3.1-Flag-EZH2 Plasmid
PVTB00699-2a	Lifescience Market	2 ug	EUR 356

EZH2 Recombinant Protein (Rat)
RP200159	ABM	100 ug	Ask for price

EZH2 Recombinant Protein (Mouse)
RP132590	ABM	100 ug	Ask for price

EZH2 Recombinant Protein (Mouse)
RP132593	ABM	100 ug	Ask for price

Anti-KMT6 / EZH2 (2C3)
YF-MA10308	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to KMT6 / EZH2

Enhancer Of Zeste Homolog 2 (EZH2) Polyclonal Antibody (Human), APC-Cy7
4-PAK073Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: EZH2 (Glu51~Phe285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Enhancer Of Zeste Homolog 2 (EZH2). This antibody is labeled with APC-Cy7.

Enhancer of Zeste Homolog 2 (EZH2) Antibody
20-abx102736	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Enhancer Of Zeste Homolog 2 (EZH2) Antibody
20-abx176281	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Phospho-EZH2(Ser475) Blocking Peptide
AF8604-BP	Affbiotech	1mg	EUR 195

Phospho-EZH2(Thr369) Blocking Peptide
AF8605-BP	Affbiotech	1mg	EUR 195

Phospho-EZH2(Thr367) Blocking Peptide
AF8606-BP	Affbiotech	1mg	EUR 195

Phospho-EZH2(Ser476) Blocking Peptide
AF8613-BP	Affbiotech	1mg	EUR 195

Phospho-Ezh2 (Thr487) Blocking Peptide
AF7400-BP	Affbiotech	1mg	EUR 195

EZH2 ORF Vector (Human) (pORF)
ORF003702	ABM	1.0 ug DNA	EUR 95

Ezh2 ORF Vector (Rat) (pORF)
ORF066721	ABM	1.0 ug DNA	EUR 506

Ezh2 ORF Vector (Mouse) (pORF)
ORF044198	ABM	1.0 ug DNA	EUR 506

Ezh2 ORF Vector (Mouse) (pORF)
ORF044199	ABM	1.0 ug DNA	EUR 95

EZH2 ELISA Kit (Human) (OKCD00588)
OKCD00588	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Polycomb group (PcG) protein. Catalytic subunit of the PRC2/EED-EZH2 complex, which methylates 'Lys-9' (H3K9me) and 'Lys-27' (H3K27me) of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Compared to EZH2-containing complexes, it is more abundant in embryonic stem cells and plays a major role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. The PRC2/EED-EZH2 complex may also serve as a recruiting platform for DNA methyltransferases, thereby linking two epigenetic repression systems. Genes repressed by the PRC2/EED-EZH2 complex include HOXC8, HOXA9, MYT1, CDKN2A and retinoic acid target genes. EZH2 can also methylate non-histone proteins such as the transcription factor GATA4 and the nuclear receptor RORA. Regulates the circadian clock via histone methylation at the promoter of the circadian genes. Essential for the CRY1/2-mediated repression of the transcriptional activation of PER1/2 by the CLOCK-ARNTL/BMAL1 heterodimer; involved in the di and trimethylation of 'Lys-27' of histone H3 on PER1/2 promoters which is necessary for the CRY1/2 proteins to inhibit transcription.16 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.15"EZH2 is downstream of the pRB-E2F pathway, essential for proliferation and amplified in cancer."_x005F_x005F_x000D_Bracken A.P., Pasini D., Capra M., Prosperini E., Colli E., Helin K._x005F_x005F_x000D_EMBO J. 22:5323-5335(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, DEVELOPMENTAL STAGE, INDUCTION, TISSUE SPECIFICITY.Ref.16"Suz12 is essential for mouse development and for EZH2 histone methyltransferase activity."_x005F_x005F_x000D_Pasini D., Bracken A.P., Jensen M.R., Lazzerini Denchi E., Helin K._x005F_x005F_x000D_EMBO J. 23:4061-4071(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH EED AND SUZ12, METHYLTRANSFERASE ACTIVITY OF THE PRC2 COMPLEX.Ref.17"Silencing of human polycomb target genes is associated with methylation of histone H3 Lys 27."_x005F_x005F_x000D_Kirmizis A., Bartley S.M., Kuzmichev A., Margueron R., Reinberg D., Green R., Farnham P.J._x005F_x005F_x000D_Genes Dev. 18:1592-1605(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.19"SUZ12 is required for both the histone methyltransferase activity and the silencing function of the EED-EZH2 complex."_x005F_x005F_x000D_Cao R., Zhang Y._x005F_x005F_x000D_Mol. Cell 15:57-67(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, CHARACTERIZATION OF THE PRC2 COMPLEX INCLUDING AEBP2; EED; EZH2; RBBP4 AND SUZ12, METHYLTRANSFERASE ACTIVITY OF THE PRC2 COMPLEX.Ref.21"The human tumor antigen PRAME is a dominant repressor of retinoic acid receptor signaling."_x005F_x005F_x000D_Epping M.T., Wang L., Edel M.J., Carlee L., Hernandez M., Bernards R._x005F_x005F_x000D_Cell 122:835-847(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION IN RETINOIC ACID SIGNALING, INTERACTION WITH PRAME.Ref.25"Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions."_x005F_x005F_x000D_Bracken A.P., Dietrich N., Pasini D., Hansen K.H., Helin K._x005F_x005F_x000D_Genes Dev. 20:1123-1136(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.27"The polycomb group protein EZH2 is required for mammalian circadian clock function."_x005F_x005F_x000D_Etchegaray J.P., Yang X., DeBruyne J.P., Peters A.H., Weaver D.R., Jenuwein T., Reppert S.M._x005F_x005F_x000D_J. Biol. Chem. 281:21209-21215(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.29"The Polycomb group protein EZH2 directly controls DNA methylation."_x005F_x005F_x000D_Vire E., Brenner C., Deplus R., Blanchon L., Fraga M., Didelot C., Morey L., Van Eynde A., Bernard D., Vanderwinden J.-M., Bollen M., Esteller M., Di Croce L., de Launoit Y., Fuks F._x005F_x005F_x000D_Nature 439:871-874(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION OF THE PRC2 COMPLEX WITH DNMT1; DNMT3A AND DNMT3B.Ref.30"Argonaute-1 directs siRNA-mediated transcriptional gene silencing in human cells."_x005F_x005F_x000D_Kim D.H., Villeneuve L.M., Morris K.V., Rossi J.J._x005F_x005F_x000D_Nat. Struct. Mol. Biol. 13:793-797(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.31"pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing p16INK4alpha tumor suppressor gene."_x005F_x005F_x000D_Kotake Y., Cao R., Viatour P., Sage J., Zhang Y., Xiong Y._x005F_x005F_x000D_Genes Dev. 21:49-54(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.32"The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells."_x005F_x005F_x000D_Bracken A.P., Kleine-Kohlbrecher D., Dietrich N., Pasini D., Gargiulo G., Beekman C., Theilgaard-Moench K., Minucci S., Porse B.T., Marine J.-C., Hansen K.H., Helin K._x005F_x005F_x000D_Genes Dev. 21:525-530(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, DEVELOPMENTAL STAGE, INDUCTION.Ref.36"Ezh1 and Ezh2 maintain repressive chromatin through different mechanisms."_x005F_x005F_x000D_Margueron R., Li G., Sarma K., Blais A., Zavadil J., Woodcock C.L., Dynlacht B.D., Reinberg D._x005F_x005F_x000D_Mol. Cell 32:503-518(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, IDENTIFICATION IN THE PRC2/EED-EZH1 COMPLEX.Ref.38"Ezh2 requires PHF1 to efficiently catalyze H3 lysine 27 trimethylation in vivo."_x005F_x005F_x000D_Sarma K., Margueron R., Ivanov A., Pirrotta V., Reinberg D._x005F_x005F_x000D_Mol. Cell. Biol. 28:2718-2731(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH EED; SUZ12 AND PHF1, METHYLTRANSFERASE ACTIVITY OF THE PRC2 COMPLEX, MUTAGENESIS OF HIS-689.Ref.43"Cyclin-dependent kinases regulate epigenetic gene silencing through phosphorylation of EZH2."_x005F_x005F_x000D_Chen S., Bohrer L.R., Rai A.N., Pan Y., Gan L., Zhou X., Bagchi A., Simon J.A., Huang H._x005F_x005F_x000D_Nat. Cell Biol. 12:1108-1114(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, PHOSPHORYLATION AT THR-345 BY CDK1 AND CDK2, MUTAGENESIS OF THR-345.Ref.47"EZH2 generates a methyl degron that is recognized by the DCAF1/DDB1/CUL4 E3 ubiquitin ligase complex."_x005F_x005F_x000D_Lee J.M., Lee J.S., Kim H., Kim K., Park H., Kim J.Y., Lee S.H., Kim I.S., Kim J., Lee M., Chung C.H., Seo S.B., Yoon J.B., Ko E., Noh D.Y., Kim K.I., Kim K.K., Baek S.H._x005F_x005F_x000D_Mol. Cell 48:572-586(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.49"O-GlcNAcylation regulates EZH2 protein stability and function."_x005F_x005F_x000D_Chu C.S., Lo P.W., Yeh Y.H., Hsu P.H., Peng S.H., Teng Y.C., Kang M.L., Wong C.H., Juan L.J._x005F_x005F_x000D_Proc. Natl. Acad. Sci. U.S.A. 111:1355-1360(2014) [PubMed] [Europe PMC] [Abstract]Cited for: GLYCOSYLATION AT SER-75, MUTAGENESIS OF SER-75, FUNCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

EZH2 ELISA Kit (Human) (OKDD00260)
OKDD00260	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

EZH2 ELISA Kit (Human) (OKEH08667)
OKEH08667	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.24 ng/mL

EZH2 ELISA Kit (Mouse) (OKEH08668)
OKEH08668	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Mouse Anti-Human EZH2 monoclonal antibody, clone JID681
CABT-L2864-100uL500uL	Creative Diagnostics	100 uL, 500 uL	EUR 502

Phospho-Ezh2 (Ser363/366) Blocking Peptide
AF7401-BP	Affbiotech	1mg	EUR 195

EZH2 sgRNA CRISPR Lentivector set (Human)
K0012701	ABM	3 x 1.0 ug	EUR 339

EZH2 sgRNA CRISPR Lentivector set (Mouse)
K3004901	ABM	3 x 1.0 ug	EUR 339

Ezh2 sgRNA CRISPR Lentivector set (Rat)
K7283401	ABM	3 x 1.0 ug	EUR 339

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

EZH2 Rabbit Polyclonal Antibody