FABP6 Rabbit Polyclonal Antibody
 FABP6 Polyclonal Antibody |
|
ES11334-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against FABP6 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 FABP6 Rabbit pAb |
|
A13491-100ul |
Abclonal |
100 ul |
EUR 308 |
FABP6 Rabbit pAb |
|
A13491-200ul |
Abclonal |
200 ul |
EUR 459 |
FABP6 Rabbit pAb |
|
A13491-20ul |
Abclonal |
20 ul |
EUR 183 |
FABP6 Rabbit pAb |
|
A13491-50ul |
Abclonal |
50 ul |
EUR 223 |
FABP6 Rabbit pAb |
|
A6906-100ul |
Abclonal |
100 ul |
EUR 308 |
FABP6 Rabbit pAb |
|
A6906-200ul |
Abclonal |
200 ul |
EUR 459 |
FABP6 Rabbit pAb |
|
A6906-20ul |
Abclonal |
20 ul |
EUR 183 |
FABP6 Rabbit pAb |
|
A6906-50ul |
Abclonal |
50 ul |
EUR 223 |
 Rabbit FABP6 ELISA Kit |
|
ERTF0046 |
Abclonal |
96Tests |
EUR 521 |
 ELISA Kit) Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
DLR-FABP6-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
DLR-FABP6-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 ELISA Kit) Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
DLR-FABP6-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
DLR-FABP6-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RDR-FABP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RDR-FABP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RDR-FABP6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RDR-FABP6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RD-FABP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RD-FABP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RD-FABP6-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) ELISA Kit |
|
RD-FABP6-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
 FABP6 Antibody |
|
36456-100ul |
SAB |
100ul |
EUR 252 |
FABP6 Antibody |
|
1-CSB-PA706521 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
FABP6 Antibody |
|
1-CSB-PA170264 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
FABP6 Antibody |
|
1-CSB-PA007955ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
FABP6 Antibody |
|
1-CSB-PA007955ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FABP6. Recognizes FABP6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
 ELISA kit) Rabbit Gastrotropin(FABP6) ELISA kit |
|
E04G0406-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Gastrotropin(FABP6) ELISA kit |
|
E04G0406-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Gastrotropin(FABP6) ELISA kit |
|
E04G0406-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Gastrotropin(FABP6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA Kit) Rabbit Gastrotropin (FABP6) ELISA Kit |
|
abx363471-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 FABP6 Conjugated Antibody |
|
C36456 |
SAB |
100ul |
EUR 397 |
 Anti-FABP6 Antibody |
|
PA2158 |
BosterBio |
100ug/vial |
EUR 334 |
 Anti-FABP6 antibody |
|
STJ28986 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. |
Anti-FABP6 antibody |
|
STJ115452 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes the ileal fatty acid binding protein. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP6 and FABP1 (the liver fatty acid binding protein) are also able to bind bile acids. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Transcript variants generated by alternate transcription promoters and/or alternate splicing have been found for this gene. |
Anti-FABP6 antibody |
|
STJ192492 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to FABP6 |
) Polyclonal I-BABP / FABP6 Antibody (aa1-142) |
|
APR07907G |
Leading Biology |
0.05ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human I-BABP / FABP6 (aa1-142). This antibody is tested and proven to work in the following applications: |
 FABP6 siRNA |
|
20-abx901820 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FABP6 siRNA |
|
20-abx915919 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FABP6 siRNA |
|
20-abx915920 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-FABP6 |
|
YF-PA11689 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to FABP6 |
anti-FABP6 |
|
YF-PA11690 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to FABP6 |
) Human Gastrotropin (FABP6) |
|
1-CSB-EP007955HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Gastrotropin(FABP6) expressed in E.coli |
 FABP6 cloning plasmid |
|
CSB-CL007955HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 387
- Sequence: atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacac
- Show more
|
|
Description: A cloning plasmid for the FABP6 gene. |
 Recombinant Human FABP6 |
|
P0126 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: P51161
|
|
Description: Recombinant Human protein for FABP6 |
) Anti-FABP6 (4A4) |
|
YF-MA12949 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to FABP6 |
 Polyclonal Antibody (Human)) Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Human) |
|
4-PAA344Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fatty Acid Binding Protein 6, Ileal (FABP6) |
 Polyclonal Antibody (Mouse)) Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Mouse) |
|
4-PAA344Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Glu10~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Fatty Acid Binding Protein 6, Ileal (FABP6) |
 Polyclonal Antibody (Pig)) Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Pig) |
|
4-PAA344Po01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2694.00
-
EUR 667.00
-
EUR 326.00
-
EUR 218.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Pig Fatty Acid Binding Protein 6, Ileal (FABP6) |
 Polyclonal Antibody (Rat)) Fatty Acid Binding Protein 6, Ileal (FABP6) Polyclonal Antibody (Rat) |
|
4-PAA344Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FABP6 (Met1~Ala128)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Fatty Acid Binding Protein 6, Ileal (FABP6) |
) FABP6 protein (isoform 2) |
|
30R-1189 |
Fitzgerald |
100 ug |
EUR 397 |
|
Description: Purified recombinant Human FABP6 protein (isoform 2) |
 Human FABP6 ELISA Kit |
|
EHF0046 |
Abclonal |
96Tests |
EUR 521 |
 Goat FABP6 ELISA Kit |
|
EGTF0046 |
Abclonal |
96Tests |
EUR 521 |
 Bovine FABP6 ELISA Kit |
|
EBF0046 |
Abclonal |
96Tests |
EUR 521 |
 Canine FABP6 ELISA Kit |
|
ECF0046 |
Abclonal |
96Tests |
EUR 521 |
 Chicken FABP6 ELISA Kit |
|
ECKF0046 |
Abclonal |
96Tests |
EUR 521 |
 Anserini FABP6 ELISA Kit |
|
EAF0046 |
Abclonal |
96Tests |
EUR 521 |
 Rat FABP6 shRNA Plasmid |
|
20-abx985027 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human FABP6 shRNA Plasmid |
|
20-abx951512 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse FABP6 shRNA Plasmid |
|
20-abx971050 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse FABP6 ELISA Kit |
|
EMF0046 |
Abclonal |
96Tests |
EUR 521 |
 Rat FABP6 ELISA Kit |
|
ERF0046 |
Abclonal |
96Tests |
EUR 521 |
 Sheep FABP6 ELISA Kit |
|
ESF0046 |
Abclonal |
96Tests |
EUR 521 |
 Monkey FABP6 ELISA Kit |
|
EMKF0046 |
Abclonal |
96Tests |
EUR 521 |
 Porcine FABP6 ELISA Kit |
|
EPF0046 |
Abclonal |
96Tests |
EUR 521 |
FABP6 Rabbit Polyclonal Antibody
