FAM3C Rabbit Polyclonal Antibody
FAM3C Polyclonal Antibody |
ABP58526-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FAM3C protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3C from Human, Mouse, Rat. This FAM3C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAM3C protein |
FAM3C Polyclonal Antibody |
ABP58526-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FAM3C protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3C from Human, Mouse, Rat. This FAM3C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAM3C protein |
FAM3C Polyclonal Antibody |
ABP58526-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FAM3C protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FAM3C from Human, Mouse, Rat. This FAM3C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FAM3C protein |
FAM3C Polyclonal Antibody |
ES10951-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FAM3C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FAM3C Polyclonal Antibody |
ES10951-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FAM3C from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FAM3C Rabbit pAb |
A18274-100ul |
Abclonal |
100 ul |
EUR 308 |
FAM3C Rabbit pAb |
A18274-200ul |
Abclonal |
200 ul |
EUR 459 |
FAM3C Rabbit pAb |
A18274-20ul |
Abclonal |
20 ul |
EUR 183 |
FAM3C Rabbit pAb |
A18274-50ul |
Abclonal |
50 ul |
EUR 223 |
FAM3C Polyclonal Conjugated Antibody |
C30389 |
SAB |
100ul |
EUR 397 |
FAM3C antibody |
70R-17220 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FAM3C antibody |
FAM3C Antibody |
1-CSB-PA856401LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
FAM3C Antibody |
DF12605 |
Affbiotech |
200ul |
EUR 304 |
Description: FAM3C Antibody detects endogenous levels of FAM3C. |
FAM3C antibody |
70R-6730 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FAM3C antibody raised against the C terminal of FAM3C |
FAM3C Antibody |
1-CSB-PA008228GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FAM3C Polyclonal Antibody, HRP Conjugated |
A67079 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
FAM3C Polyclonal Antibody, FITC Conjugated |
A67080 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
FAM3C Polyclonal Antibody, Biotin Conjugated |
A67081 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Polyclonal ILEI / FAM3C Antibody (aa40-80) |
APR02436G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ILEI / FAM3C (aa40-80). This antibody is tested and proven to work in the following applications: |
anti- FAM3C antibody |
FNab02981 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: family with sequence similarity 3, member C
- Uniprot ID: Q92520
- Gene ID: 10447
- Research Area: Cell Division and Proliferation, Signal Transduction
|
Description: Antibody raised against FAM3C |
anti- FAM3C antibody |
FNab02982 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:50-1:500
- IF: 1:50-1:500
- Immunogen: family with sequence similarity 3, member C
- Uniprot ID: Q92520
- Gene ID: 10447
- Research Area: Cell Division and Proliferation, Signal Transduction
|
Description: Antibody raised against FAM3C |
Anti-FAM3C antibody |
STJ11100230 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. |
Anti-FAM3C antibody |
STJ192109 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FAM3C |
Human Protein FAM3C(FAM3C) ELISA kit |
CSB-EL008228HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3C (FAM3C) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Protein FAM3C(FAM3C) ELISA kit |
1-CSB-EL008228HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Protein FAM3C(FAM3C) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Protein FAM3C(FAM3C) ELISA kit |
CSB-EL008228MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3C (FAM3C) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Protein FAM3C(FAM3C) ELISA kit |
1-CSB-EL008228MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Protein FAM3C(FAM3C) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Protein FAM3C (FAM3C) ELISA Kit |
abx387273-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
FAM3C siRNA |
20-abx901877 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAM3C siRNA |
20-abx916318 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAM3C siRNA |
20-abx916319 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FAM3C Antibody, HRP conjugated |
1-CSB-PA856401LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
FAM3C Antibody, FITC conjugated |
1-CSB-PA856401LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
FAM3C Antibody, Biotin conjugated |
1-CSB-PA856401LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FAM3C. Recognizes FAM3C from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
FAM3C Blocking Peptide |
33R-2091 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAM3C antibody, catalog no. 70R-6730 |
FAM3C Blocking Peptide |
DF12605-BP |
Affbiotech |
1mg |
EUR 195 |
FAM3C cloning plasmid |
CSB-CL856401HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 684
- Sequence: atgagggtagcaggtgctgcaaagttggtggtagctgtggcagtgtttttactgacattttatgttatttctcaagtatttgaaataaaaatggatgcaagtttaggaaatctatttgcaagatcagcattggacacagctgcacgttctacaaagcctcccagatataagtgtgg
- Show more
|
Description: A cloning plasmid for the FAM3C gene. |
Anti-FAM3C (3A3) |
YF-MA17308 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FAM3C |
FAM3C Rabbit Polyclonal Antibody