FCRL1 Rabbit Polyclonal Antibody

FCRL1 Rabbit Polyclonal Antibody

FCRL1 Polyclonal Antibody
ABP58540-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FCRL1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL1 from Human, Mouse. This FCRL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL1 protein

FCRL1 Polyclonal Antibody
ES11093-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FCRL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FCRL1 Polyclonal Antibody
ES11093-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FCRL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FCRL1 antibody
70R-1853 100 ug
EUR 377
Description: Rabbit polyclonal FCRL1 antibody raised against the N terminal of FCRL1

Anti-FCRL1 antibody
STJ73124 100 µg
EUR 359

Anti-FCRL1 antibody
STJ192251 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FCRL1

FCRL1 siRNA
20-abx916711
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FCRL1 siRNA
20-abx916712
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FCRL1
YF-PA21927 50 ul
EUR 363
Description: Mouse polyclonal to FCRL1

anti-FCRL1
YF-PA21928 50 ug
EUR 363
Description: Mouse polyclonal to FCRL1

anti-FCRL1
YF-PA26826 50 ul
EUR 334
Description: Mouse polyclonal to FCRL1

Polyclonal Goat Anti-FCRL1 Antibody (C Terminus)
APG00972G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FCRL1 (C Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-FCRL1 Antibody (internal region)
APG00977G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FCRL1 (internal region). This antibody is tested and proven to work in the following applications:

FCRL1 Blocking Peptide
33R-6201 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCRL1 antibody, catalog no. 70R-1853

FCRL1 cloning plasmid
CSB-CL836248HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1290
  • Sequence: atgctgccgaggctgttgctgttgatctgtgctccactctgtgaacctgccgagctgtttttgatagccagcccctcccatcccacagaggggagcccagtgaccctgacgtgtaagatgccctttctacagagttcagatgcccagttccagttctgctttttcagagacaccc
  • Show more
Description: A cloning plasmid for the FCRL1 gene.

Anti-FCRL1 (aa165-177) antibody
STJ73123 100 µg
EUR 359

Human FCRL1 shRNA Plasmid
20-abx964441
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FCRL1 shRNA Plasmid
20-abx981697
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FCRL1 Recombinant Protein (Human)
RP012019 100 ug Ask for price

FCRL1 Recombinant Protein (Mouse)
RP134252 100 ug Ask for price

FCRL1 Recombinant Protein (Mouse)
RP134255 100 ug Ask for price

FCRL1 Recombinant Protein (Mouse)
RP134258 100 ug Ask for price

Fc Receptor-Like Protein 1 (FCRL1) Antibody
abx030308-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 1 (FCRL1) Antibody
abx030308-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 1 (FCRL1) Antibody
abx432683-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fc Receptor-Like Protein 1 (FCRL1) Antibody
abx432684-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human FCRL1 PicoKine ELISA Kit
EK1930 96 wells
EUR 425
Description: For quantitative detection of human FCRL1 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse FCRL1 PicoKine ELISA Kit
EK1977 96 wells
EUR 425
Description: For quantitative detection of mouse FCRL1 in cell culture supernates, serum and plasma (heparin, EDTA).

FCRL1 ORF Vector (Human) (pORF)
ORF004007 1.0 ug DNA
EUR 95

Fcrl1 ORF Vector (Mouse) (pORF)
ORF044752 1.0 ug DNA
EUR 506

Fcrl1 ORF Vector (Mouse) (pORF)
ORF044753 1.0 ug DNA
EUR 506

Fcrl1 ORF Vector (Mouse) (pORF)
ORF044754 1.0 ug DNA
EUR 506

FCRL1 ELISA Kit (Human) (OKBB01308)
OKBB01308 96 Wells
EUR 505
Description: Description of target: Fc receptor-like protein 1 is a protein that in humans is encoded by the FCRL1 gene. It is mapped to 1q23.1. This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein contains three extracellular C2-like immunoglobulin domains, a transmembrane domain and a cytoplasmic domain with two immunoreceptor-tyrosine activation motifs. This protein may play a role in the regulation of cancer cell growth. Alternative splicing results in multiple transcript variants. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <20pg/ml

Rabbit Anti-Human FcRL1/FcRH1 Protein (1-303aa) IgG, af pure
FCRL151-A 100 ug
EUR 482

Rabbit Anti-Mouse FcRL1/FcRH1 Protein (1-204aa) IgG, aff pure
FCRL161-A 100 ug
EUR 482

FCRL1 sgRNA CRISPR Lentivector set (Human)
K0770801 3 x 1.0 ug
EUR 339

Fcrl1 sgRNA CRISPR Lentivector set (Mouse)
K3686501 3 x 1.0 ug
EUR 339

FCRL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0770802 1.0 ug DNA
EUR 154

FCRL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0770803 1.0 ug DNA
EUR 154

FCRL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0770804 1.0 ug DNA
EUR 154

Fcrl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3686502 1.0 ug DNA
EUR 154

Fcrl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3686503 1.0 ug DNA
EUR 154

Fcrl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3686504 1.0 ug DNA
EUR 154

FCRL1 Protein Vector (Mouse) (pPB-C-His)
PV179006 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPB-N-His)
PV179007 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPM-C-HA)
PV179008 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPM-C-His)
PV179009 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPB-C-His)
PV179010 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPB-N-His)
PV179011 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPM-C-HA)
PV179012 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPM-C-His)
PV179013 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPB-C-His)
PV179014 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPB-N-His)
PV179015 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPM-C-HA)
PV179016 500 ng
EUR 603

FCRL1 Protein Vector (Mouse) (pPM-C-His)
PV179017 500 ng
EUR 603

FCRL1 Protein Vector (Human) (pPB-C-His)
PV016025 500 ng
EUR 329

FCRL1 Protein Vector (Human) (pPB-N-His)
PV016026 500 ng
EUR 329

FCRL1 Protein Vector (Human) (pPM-C-HA)
PV016027 500 ng
EUR 329

FCRL1 Protein Vector (Human) (pPM-C-His)
PV016028 500 ng
EUR 329

Fcrl1 3'UTR GFP Stable Cell Line
TU156486 1.0 ml Ask for price

Fcrl1 3'UTR Luciferase Stable Cell Line
TU106486 1.0 ml Ask for price

Fcrl1 3'UTR Luciferase Stable Cell Line
TU204554 1.0 ml Ask for price

Fcrl1 3'UTR GFP Stable Cell Line
TU254554 1.0 ml Ask for price

FCRL1 3'UTR GFP Stable Cell Line
TU057848 1.0 ml
EUR 1521

FCRL1 3'UTR Luciferase Stable Cell Line
TU007848 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

FCRL1 Rabbit Polyclonal Antibody