FCRL4 Rabbit Polyclonal Antibody
FCRL4 Polyclonal Antibody |
ABP58542-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FCRL4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FCRL4 from Human. This FCRL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL4 protein |
FCRL4 Polyclonal Antibody |
ABP58542-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FCRL4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FCRL4 from Human. This FCRL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL4 protein |
FCRL4 Polyclonal Antibody |
ABP58542-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FCRL4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FCRL4 from Human. This FCRL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL4 protein |
FCRL4 Polyclonal Antibody |
A59118 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
FCRL4 Polyclonal Antibody |
27378-100ul |
SAB |
100ul |
EUR 252 |
FCRL4 Polyclonal Antibody |
27378-50ul |
SAB |
50ul |
EUR 187 |
FCRL4 Rabbit pAb |
A10329-100ul |
Abclonal |
100 ul |
EUR 308 |
FCRL4 Rabbit pAb |
A10329-200ul |
Abclonal |
200 ul |
EUR 459 |
FCRL4 Rabbit pAb |
A10329-20ul |
Abclonal |
20 ul |
EUR 183 |
FCRL4 Rabbit pAb |
A10329-50ul |
Abclonal |
50 ul |
EUR 223 |
FCRL4 Polyclonal Conjugated Antibody |
C27378 |
SAB |
100ul |
EUR 397 |
FCRL4 antibody |
70R-7228 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FCRL4 antibody raised against the N terminal of FCRL4 |
FCRL4 antibody |
70R-7229 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FCRL4 antibody raised against the N terminal of FCRL4 |
FCRL4 Antibody |
40042-100ul |
SAB |
100ul |
EUR 390 |
FCRL4 Antibody |
DF10173 |
Affbiotech |
200ul |
EUR 304 |
Description: FCRL4 Antibody detects endogenous levels of total FCRL4. |
FCRL4 Antibody |
1-CSB-PA836277LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
Polyclonal FCRL4 Antibody (C-term) |
APR06205G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCRL4 (C-term). This antibody is tested and proven to work in the following applications: |
FCRL4 Polyclonal Antibody, Biotin Conjugated |
A59119 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
FCRL4 Polyclonal Antibody, FITC Conjugated |
A59120 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
FCRL4 Polyclonal Antibody, HRP Conjugated |
A59121 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Anti-FCRL4 antibody |
STJ112367 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein has four extracellular C2-type immunoglobulin domains, a transmembrane domain and a cytoplasmic domain that contains three immune-receptor tyrosine-based inhibitory motifs. This protein may play a role in the function of memory B-cells in the epithelia. Aberrations in the chromosomal region encoding this gene are associated with non-Hodgkin lymphoma and multiple myeloma. |
Anti-FCRL4 antibody |
STJ192104 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FCRL4 |
FCRL4 siRNA |
20-abx916715 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FCRL4 Antibody, HRP conjugated |
1-CSB-PA836277LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
FCRL4 Antibody, FITC conjugated |
1-CSB-PA836277LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
FCRL4 Antibody, Biotin conjugated |
1-CSB-PA836277LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
FCRL4 Blocking Peptide |
33R-4431 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCRL4 antibody, catalog no. 70R-7229 |
FCRL4 Blocking Peptide |
33R-2948 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCRL4 antibody, catalog no. 70R-7228 |
FCRL4 Blocking Peptide |
DF10173-BP |
Affbiotech |
1mg |
EUR 195 |
FCRL4 cloning plasmid |
CSB-CL836277HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1548
- Sequence: ATGCTGCTGTGGGCGTCCTTGCTGGCCTTTGCTCCAGTCTGTGGACAATCTGCAGCTGCACACAAACCTGTGATTTCCGTCCATCCTCCATGGACCACATTCTTCAAAGGAGAGAGAGTGACTCTGACTTGCAATGGATTTCAGTTCTATGCAACAGAGAAAACAACATGGTATC
- Show more
|
Description: A cloning plasmid for the FCRL4 gene. |
Human FCRL4 shRNA Plasmid |
20-abx963092 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FCRL4 Recombinant Protein (Human) |
RP039067 |
ABM |
100 ug |
Ask for price |
FCRL4 ORF Vector (Human) (pORF) |
ORF013023 |
ABM |
1.0 ug DNA |
EUR 95 |
Fc Receptor-Like Protein 4 (FCRL4) Antibody |
20-abx125844 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fc Receptor-Like Protein 4 (FCRL4) Antibody |
abx037262-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fc Receptor-Like Protein 4 (FCRL4) Antibody |
20-abx318313 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
FCRL4 Rabbit Polyclonal Antibody