CelltaGen
셀타젠 Genetic Genotyping

FCRL4 Rabbit Polyclonal Antibody

FCRL4 Rabbit Polyclonal Antibody

FCRL4 Polyclonal Antibody
ABP58542-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FCRL4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL4 from Human. This FCRL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL4 protein

FCRL4 Polyclonal Antibody
ABP58542-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FCRL4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL4 from Human. This FCRL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL4 protein

FCRL4 Polyclonal Antibody
ABP58542-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FCRL4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FCRL4 from Human. This FCRL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FCRL4 protein

FCRL4 Polyclonal Antibody
A59118 100 µg
EUR 570.55
Description: The best epigenetics products

FCRL4 Polyclonal Antibody
27378-100ul 100ul
EUR 252

FCRL4 Polyclonal Antibody
27378-50ul 50ul
EUR 187

Rabbit Anti-Human FCRL4 polyclonal antibody
CABT-BL140 100 ul
EUR 585

FCRL4 Rabbit pAb
A10329-100ul 100 ul
EUR 308

FCRL4 Rabbit pAb
A10329-200ul 200 ul
EUR 459

FCRL4 Rabbit pAb
A10329-20ul 20 ul
EUR 183

FCRL4 Rabbit pAb
A10329-50ul 50 ul
EUR 223

FCRL4 Polyclonal Conjugated Antibody
C27378 100ul
EUR 397

FCRL4 antibody
70R-7228 50 ug
EUR 467
Description: Rabbit polyclonal FCRL4 antibody raised against the N terminal of FCRL4

FCRL4 antibody
70R-7229 50 ug
EUR 467
Description: Rabbit polyclonal FCRL4 antibody raised against the N terminal of FCRL4

FCRL4 Antibody
ABD10173 100 ug
EUR 438

FCRL4 Antibody
40042-100ul 100ul
EUR 390

FCRL4 Antibody
DF10173 200ul
EUR 304
Description: FCRL4 Antibody detects endogenous levels of total FCRL4.

FCRL4 Antibody
1-CSB-PA836277LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Polyclonal FCRL4 Antibody (C-term)
APR06205G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCRL4 (C-term). This antibody is tested and proven to work in the following applications:

FCRL4 Polyclonal Antibody, Biotin Conjugated
A59119 100 µg
EUR 570.55
Description: kits suitable for this type of research

FCRL4 Polyclonal Antibody, FITC Conjugated
A59120 100 µg
EUR 570.55
Description: fast delivery possible

FCRL4 Polyclonal Antibody, HRP Conjugated
A59121 100 µg
EUR 570.55
Description: reagents widely cited

Anti-FCRL4 antibody
STJ112367 100 µl
EUR 277
Description: This gene encodes a member of the immunoglobulin receptor superfamily and is one of several Fc receptor-like glycoproteins clustered on the long arm of chromosome 1. The encoded protein has four extracellular C2-type immunoglobulin domains, a transmembrane domain and a cytoplasmic domain that contains three immune-receptor tyrosine-based inhibitory motifs. This protein may play a role in the function of memory B-cells in the epithelia. Aberrations in the chromosomal region encoding this gene are associated with non-Hodgkin lymphoma and multiple myeloma.

Anti-FCRL4 antibody
STJ192104 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FCRL4

FCRL4 siRNA
20-abx916715
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FCRL4 Antibody, HRP conjugated
1-CSB-PA836277LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FCRL4 Antibody, FITC conjugated
1-CSB-PA836277LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FCRL4 Antibody, Biotin conjugated
1-CSB-PA836277LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCRL4. Recognizes FCRL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FCRL4 Blocking Peptide
33R-4431 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCRL4 antibody, catalog no. 70R-7229

FCRL4 Blocking Peptide
33R-2948 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FCRL4 antibody, catalog no. 70R-7228

FCRL4 Blocking Peptide
DF10173-BP 1mg
EUR 195

FCRL4 cloning plasmid
CSB-CL836277HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1548
  • Sequence: ATGCTGCTGTGGGCGTCCTTGCTGGCCTTTGCTCCAGTCTGTGGACAATCTGCAGCTGCACACAAACCTGTGATTTCCGTCCATCCTCCATGGACCACATTCTTCAAAGGAGAGAGAGTGACTCTGACTTGCAATGGATTTCAGTTCTATGCAACAGAGAAAACAACATGGTATC
  • Show more
Description: A cloning plasmid for the FCRL4 gene.

Human FCRL4 shRNA Plasmid
20-abx963092
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FCRL4 Recombinant Protein (Human)
RP039067 100 ug Ask for price

FCRL4 ORF Vector (Human) (pORF)
ORF013023 1.0 ug DNA
EUR 95

Fc Receptor-Like Protein 4 (FCRL4) Antibody
20-abx125844
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 4 (FCRL4) Antibody
abx037262-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fc Receptor-Like Protein 4 (FCRL4) Antibody
20-abx318313
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FCRL4 Rabbit Polyclonal Antibody

CelltaGen