FHL2 Rabbit Polyclonal Antibody
FHL2 Polyclonal Antibody |
ABP58553-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FHL2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FHL2 from Human, Mouse, Rat. This FHL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FHL2 protein |
FHL2 Polyclonal Antibody |
ES11019-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FHL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FHL2 Polyclonal Antibody |
ES11019-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FHL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FHL2 Rabbit pAb |
A1907-100ul |
Abclonal |
100 ul |
EUR 308 |
FHL2 Rabbit pAb |
A1907-200ul |
Abclonal |
200 ul |
EUR 459 |
FHL2 Rabbit pAb |
A1907-20ul |
Abclonal |
20 ul |
EUR 183 |
FHL2 Rabbit pAb |
A1907-50ul |
Abclonal |
50 ul |
EUR 223 |
FHL2 antibody |
20R-1089 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal FHL2 antibody |
FHL2 Antibody |
21692-100ul |
SAB |
100ul |
EUR 252 |
FHL2 Antibody |
21692-50ul |
SAB |
50ul |
EUR 187 |
FHL2 antibody |
70R-17302 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FHL2 antibody |
FHL2 antibody |
10R-10403 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Mouse monoclonal FHL2 antibody |
FHL2 Antibody |
49904-100ul |
SAB |
100ul |
EUR 333 |
FHL2 Antibody |
49904-50ul |
SAB |
50ul |
EUR 239 |
FHL2 Antibody |
CSB-PA131696- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
FHL2 Antibody |
CSB-PA131696-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
FHL2 Antibody |
1-CSB-PA617906LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
FHL2 Antibody |
1-CSB-PA664930 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
FHL2 Antibody |
1-CSB-PA798885 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300 |
FHL2 Antibody |
DF13015 |
Affbiotech |
200ul |
EUR 304 |
Description: FHL2 Antibody detects endogenous levels of FHL2. |
FHL2 antibody |
70R-49745 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal FHL2 antibody |
FHL2 Antibody |
1-CSB-PA008664GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FHL2 Conjugated Antibody |
C49904 |
SAB |
100ul |
EUR 397 |
FHL2 Conjugated Antibody |
C21692 |
SAB |
100ul |
EUR 397 |
anti- FHL2 antibody |
FNab03111 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: four and a half LIM domains 2
- Uniprot ID: Q14192
- Gene ID: 2274
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against FHL2 |
Anti-FHL2 antibody |
STJ23664 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. This protein is thought to have a role in the assembly of extracellular membranes. Also, this gene is down-regulated during transformation of normal myoblasts to rhabdomyosarcoma cells and the encoded protein may function as a link between presenilin-2 and an intracellular signaling pathway. Multiple alternatively spliced variants encoding different isoforms have been identified. |
Anti-FHL2 antibody |
STJ192177 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FHL2 |
FHL2 siRNA |
20-abx901966 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FHL2 siRNA |
20-abx916876 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FHL2 siRNA |
20-abx916877 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FHL2 |
YF-PA11787 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FHL2 |
anti-FHL2 |
YF-PA11788 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to FHL2 |
anti-FHL2 |
YF-PA23715 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to FHL2 |
FHL2 Antibody, HRP conjugated |
1-CSB-PA617906LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
FHL2 Antibody, FITC conjugated |
1-CSB-PA617906LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
FHL2 Antibody, Biotin conjugated |
1-CSB-PA617906LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FHL2. Recognizes FHL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
FHL2 Blocking Peptide |
33R-7909 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FHL2 antibody, catalog no. 20R-1089 |
FHL2 Blocking Peptide |
DF13015-BP |
Affbiotech |
1mg |
EUR 195 |
FHL2 cloning plasmid |
CSB-CL617906HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 840
- Sequence: atgactgagcgctttgactgccaccattgcaacgaatctctctttggcaagaagtacatcctgcgggaggagagcccctactgcgtggtgtgctttgagaccctgttcgccaacacctgcgaggagtgtgggaagcccatcggctgtgactgcaaggacttgtcttacaaggaccg
- Show more
|
Description: A cloning plasmid for the FHL2 gene. |
FHL2 protein (His tag) |
80R-3992 |
Fitzgerald |
100 ug |
EUR 435 |
Description: Recombinant Human FHL2 protein |
Rat FHL2 shRNA Plasmid |
20-abx986093 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse FHL2 shRNA Plasmid |
20-abx970339 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FHL2 shRNA Plasmid |
20-abx951591 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FHL2 Recombinant Protein (Human) |
RP012169 |
ABM |
100 ug |
Ask for price |
FHL2 Recombinant Protein (Rat) |
RP201398 |
ABM |
100 ug |
Ask for price |
FHL2 Recombinant Protein (Mouse) |
RP134600 |
ABM |
100 ug |
Ask for price |
Anti-FHL2 (2G3-1A5) |
YF-MA13025 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to FHL2 |
Fhl2 ORF Vector (Rat) (pORF) |
ORF067134 |
ABM |
1.0 ug DNA |
EUR 506 |
FHL2 ORF Vector (Human) (pORF) |
ORF004057 |
ABM |
1.0 ug DNA |
EUR 95 |
Fhl2 ORF Vector (Mouse) (pORF) |
ORF044868 |
ABM |
1.0 ug DNA |
EUR 506 |
FHL2 ELISA Kit (Mouse) (OKEH03684) |
OKEH03684 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: May function as a molecular transmitter linking various signaling pathways to transcriptional regulation. Negatively regulates the transcriptional repressor E4F1 and may function in cell growth. Inhibits the transcriptional activity of FOXO1 and its apoptotic function by enhancing the interaction of FOXO1 with SIRT1 and FOXO1 deacetylation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.09 pg/mL |
Fhl2 sgRNA CRISPR Lentivector set (Rat) |
K6889701 |
ABM |
3 x 1.0 ug |
EUR 339 |
FHL2 sgRNA CRISPR Lentivector set (Human) |
K0781901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fhl2 sgRNA CRISPR Lentivector set (Mouse) |
K3796201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fhl2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6889702 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6889703 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6889704 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0781902 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0781903 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0781904 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3796202 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3796203 |
ABM |
1.0 ug DNA |
EUR 154 |
Fhl2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3796204 |
ABM |
1.0 ug DNA |
EUR 154 |
FHL2 Protein Vector (Mouse) (pPB-C-His) |
PV179470 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Mouse) (pPB-N-His) |
PV179471 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Mouse) (pPM-C-HA) |
PV179472 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Mouse) (pPM-C-His) |
PV179473 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Rat) (pPB-C-His) |
PV268534 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Rat) (pPB-N-His) |
PV268535 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Rat) (pPM-C-HA) |
PV268536 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Rat) (pPM-C-His) |
PV268537 |
ABM |
500 ng |
EUR 603 |
FHL2 Protein Vector (Human) (pPB-C-His) |
PV016225 |
ABM |
500 ng |
EUR 329 |
FHL2 Protein Vector (Human) (pPB-N-His) |
PV016226 |
ABM |
500 ng |
EUR 329 |
FHL2 Protein Vector (Human) (pPM-C-HA) |
PV016227 |
ABM |
500 ng |
EUR 329 |
FHL2 Protein Vector (Human) (pPM-C-His) |
PV016228 |
ABM |
500 ng |
EUR 329 |
Recombinant Human FHL2 Protein, His, E.coli-1mg |
QP11879-1mg |
EnQuireBio |
1mg |
EUR 3655 |
Recombinant Human FHL2 Protein, His, E.coli-25ug |
QP11879-25ug |
EnQuireBio |
25ug |
EUR 201 |
Recombinant Human FHL2 Protein, His, E.coli-5ug |
QP11879-5ug |
EnQuireBio |
5ug |
EUR 155 |
Fhl2 3'UTR GFP Stable Cell Line |
TU156569 |
ABM |
1.0 ml |
Ask for price |
Fhl2 3'UTR Luciferase Stable Cell Line |
TU106569 |
ABM |
1.0 ml |
Ask for price |
Fhl2 3'UTR Luciferase Stable Cell Line |
TU204633 |
ABM |
1.0 ml |
Ask for price |
Fhl2 3'UTR GFP Stable Cell Line |
TU254633 |
ABM |
1.0 ml |
Ask for price |
FHL2 3'UTR GFP Stable Cell Line |
TU057968 |
ABM |
1.0 ml |
EUR 4617 |
FHL2 3'UTR Luciferase Stable Cell Line |
TU007968 |
ABM |
1.0 ml |
EUR 4617 |
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
20-abx009263 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
20-abx006709 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
abx018189-100ug |
Abbexa |
100 ug |
EUR 384 |
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
20-abx214977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
20-abx112585 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
abx145821-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
20-abx241030 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
abx233111-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
abx330443-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
abx431253-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Four And A Half LIM Domains Protein 2 (FHL2) Antibody |
20-abx302230 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
FHL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV676891 |
ABM |
1.0 ug DNA |
EUR 514 |
FHL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV676895 |
ABM |
1.0 ug DNA |
EUR 514 |
FHL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV676896 |
ABM |
1.0 ug DNA |
EUR 514 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
FHL2 Rabbit Polyclonal Antibody