
셀타젠 Genetic Genotyping

FKBP2 Rabbit Polyclonal Antibody

FKBP2 Rabbit Polyclonal Antibody

FKBP2 Polyclonal Antibody

ABP58562-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160

FKBP2 Polyclonal Antibody

ABP58562-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160

FKBP2 Polyclonal Antibody

31443-100ul 100ul
EUR 252

FKBP2 Polyclonal Antibody

31443-50ul 50ul
EUR 187

FKBP2 Rabbit pAb

A11845-100ul 100 ul
EUR 308

FKBP2 Rabbit pAb

A11845-200ul 200 ul
EUR 459

FKBP2 Rabbit pAb

A11845-20ul 20 ul Ask for price

FKBP2 Rabbit pAb

A11845-50ul 50 ul Ask for price

FKBP2 Rabbit pAb

A8120-100ul 100 ul
EUR 308

FKBP2 Rabbit pAb

A8120-200ul 200 ul
EUR 459

FKBP2 Rabbit pAb

A8120-20ul 20 ul
EUR 183

FKBP2 Rabbit pAb

A8120-50ul 50 ul
EUR 223

FKBP2 Polyclonal Conjugated Antibody

C31443 100ul
EUR 397

FKBP2 antibody

70R-5298 50 ug
EUR 467
Description: Rabbit polyclonal FKBP2 antibody raised against the N terminal of FKBP2

FKBP2 antibody

70R-17310 50 ul
EUR 435
Description: Rabbit polyclonal FKBP2 antibody

FKBP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FKBP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

FKBP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal FKBP2 Antibody (N-term)

APR15987G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP2 (N-term). This antibody is tested and proven to work in the following applications:

anti- FKBP2 antibody

FNab03138 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: FK506 binding protein 2, 13kDa
  • Uniprot ID: P26885
  • Gene ID: 2286
  • Research Area: Metabolism
Description: Antibody raised against FKBP2

anti- FKBP2 antibody

FNab03139 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: FK506 binding protein 2, 13kDa
  • Uniprot ID: P26885
  • Gene ID: 2286
  • Research Area: Metabolism
Description: Antibody raised against FKBP2

Human FKBP2 Antibody

32851-05111 150 ug
EUR 261

Anti-FKBP2 antibody

PAab03138 100 ug
EUR 355

Anti-FKBP2 antibody

STJ110419 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-FKBP2 antibody

STJ113424 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-FKBP2 antibody

STJ192471 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FKBP2 protein

30R-1506 50 ug
EUR 305
Description: Purified recombinant Human FKBP2 protein

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2)

FKBP2 cloning plasmid

CSB-CL008698HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaa
  • Show more
Description: A cloning plasmid for the FKBP2 gene.

FKBP2 Blocking Peptide

33R-8052 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP2 antibody, catalog no. 70R-5298

Human Recombinant FKBP2

EUR 457


PVT12385 2 ug
EUR 391

Human FKBP2 Antibody (Biotin Conjugate)

32851-05121 150 ug
EUR 369

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with APC.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Biotin.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Cy3.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with FITC.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with HRP.

FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP2 (Met1~Leu142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with PE.

FK506 Binding Protein 2 (FKBP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx122884-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx032962-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

abx032962-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 2 (FKBP2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FKBP2 Rabbit Polyclonal Antibody