FKBP2 Rabbit Polyclonal Antibody
 FKBP2 Polyclonal Antibody |
|
ABP58562-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160
- Applications tips:
|
|
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160 |
FKBP2 Polyclonal Antibody |
|
ABP58562-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160
- Applications tips:
|
|
Description: A polyclonal antibody for detection of FKBP2 from Human, Mouse. This FKBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP2 protein at amino acid sequence of 80-160 |
FKBP2 Polyclonal Antibody |
|
31443-100ul |
SAB |
100ul |
EUR 252 |
FKBP2 Polyclonal Antibody |
|
31443-50ul |
SAB |
50ul |
EUR 187 |
 FKBP2 Rabbit pAb |
|
A11845-100ul |
Abclonal |
100 ul |
EUR 308 |
FKBP2 Rabbit pAb |
|
A11845-200ul |
Abclonal |
200 ul |
EUR 459 |
FKBP2 Rabbit pAb |
|
A11845-20ul |
Abclonal |
20 ul |
Ask for price |
FKBP2 Rabbit pAb |
|
A11845-50ul |
Abclonal |
50 ul |
Ask for price |
FKBP2 Rabbit pAb |
|
A8120-100ul |
Abclonal |
100 ul |
EUR 308 |
FKBP2 Rabbit pAb |
|
A8120-200ul |
Abclonal |
200 ul |
EUR 459 |
FKBP2 Rabbit pAb |
|
A8120-20ul |
Abclonal |
20 ul |
EUR 183 |
FKBP2 Rabbit pAb |
|
A8120-50ul |
Abclonal |
50 ul |
EUR 223 |
 FKBP2 Polyclonal Conjugated Antibody |
|
C31443 |
SAB |
100ul |
EUR 397 |
 FKBP2 antibody |
|
70R-5298 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal FKBP2 antibody raised against the N terminal of FKBP2 |
FKBP2 antibody |
|
70R-17310 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal FKBP2 antibody |
 FKBP2 Antibody |
|
1-CSB-PA008698ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
FKBP2 Antibody |
|
1-CSB-PA008698ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200 |
FKBP2 Antibody |
|
1-CSB-PA008698GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FKBP2. Recognizes FKBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
) Polyclonal FKBP2 Antibody (N-term) |
|
APR15987G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP2 (N-term). This antibody is tested and proven to work in the following applications: |
 anti- FKBP2 antibody |
|
FNab03138 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:100 - 1:200
- IF: 1:50 - 1:200
- Immunogen: FK506 binding protein 2, 13kDa
- Uniprot ID: P26885
- Gene ID: 2286
- Research Area: Metabolism
|
|
Description: Antibody raised against FKBP2 |
anti- FKBP2 antibody |
|
FNab03139 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:50-1:500
- Immunogen: FK506 binding protein 2, 13kDa
- Uniprot ID: P26885
- Gene ID: 2286
- Research Area: Metabolism
|
|
Description: Antibody raised against FKBP2 |
 Human FKBP2 Antibody |
|
32851-05111 |
AssayPro |
150 ug |
EUR 261 |
 Anti-FKBP2 antibody |
|
STJ110419 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-FKBP2 antibody |
|
STJ113424 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It is thought to function as an ER chaperone and may also act as a component of membrane cytoskeletal scaffolds. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-FKBP2 antibody |
|
STJ192471 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to FKBP2 |
 FKBP2 siRNA |
|
20-abx916934 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FKBP2 siRNA |
|
20-abx916935 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 FKBP2 protein |
|
30R-1506 |
Fitzgerald |
50 ug |
EUR 305 |
|
Description: Purified recombinant Human FKBP2 protein |
 Polyclonal Antibody (Human)) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human) |
|
4-PAC479Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2) |
 FKBP2 cloning plasmid |
|
CSB-CL008698HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 429
- Sequence: atgaggctgagctggttccgggtcctgacagtactgtccatctgcctgagcgccgtggccacggccacgggggccgagggcaaaaggaagctgcagatcggggtcaagaagcgggtggaccactgtcccatcaaatcgcgcaaaggggatgtcctgcacatgcactacacggggaa
- Show more
|
|
Description: A cloning plasmid for the FKBP2 gene. |
 FKBP2 Blocking Peptide |
|
33R-8052 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP2 antibody, catalog no. 70R-5298 |
 Human Recombinant FKBP2 |
|
6353-50 |
Biovision |
|
EUR 457 |
) Human FKBP2 Antibody (Biotin Conjugate) |
|
32851-05121 |
AssayPro |
150 ug |
EUR 369 |
 Polyclonal Antibody (Human), APC) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), APC |
|
4-PAC479Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAC479Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), Cy3 |
|
4-PAC479Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), FITC |
|
4-PAC479Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), HRP |
|
4-PAC479Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) FK506 Binding Protein 2 (FKBP2) Polyclonal Antibody (Human), PE |
|
4-PAC479Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FKBP2 (Met1~Leu142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 2 (FKBP2). This antibody is labeled with PE. |
 Antibody) FK506 Binding Protein 2 (FKBP2) Antibody |
|
20-abx126911 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
20-abx112549 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
20-abx131036 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
abx122884-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
abx032962-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
abx032962-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
20-abx006068 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
FK506 Binding Protein 2 (FKBP2) Antibody |
|
20-abx320468 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FKBP2 Rabbit Polyclonal Antibody
