셀타젠 Genetic Genotyping

FKBP8 Rabbit Polyclonal Antibody

FKBP8 Polyclonal Antibody

ABP58566-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FKBP8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FKBP8 from Human, Mouse, Rat. This FKBP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP8 protein

FKBP8 Polyclonal Antibody

ES10998-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Polyclonal Antibody

ES10998-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Rabbit pAb

A1268-100ul 100 ul
EUR 384

FKBP8 Rabbit pAb

A1268-200ul 200 ul Ask for price

FKBP8 Rabbit pAb

A1268-20ul 20 ul Ask for price

FKBP8 Rabbit pAb

A1268-50ul 50 ul
EUR 265

FKBP8 Rabbit pAb

A7085-100ul 100 ul
EUR 308

FKBP8 Rabbit pAb

A7085-200ul 200 ul
EUR 459

FKBP8 Rabbit pAb

A7085-20ul 20 ul
EUR 183

FKBP8 Rabbit pAb

A7085-50ul 50 ul
EUR 223

Polyclonal FKBP8 Antibody (Center)

APR05693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP8 (Center). This antibody is tested and proven to work in the following applications:

FKBP8 antibody

70R-17315 50 ul
EUR 435
Description: Rabbit polyclonal FKBP8 antibody

FKBP8 antibody

70R-12792 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal FKBP8 antibody

FKBP8 Antibody

36485-100ul 100ul
EUR 252

FKBP8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FKBP8 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FKBP8 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

FKBP8 antibody

70R-5950 50 ug
EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the N terminal of FKBP8

FKBP8 antibody

70R-5951 50 ug
EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the C terminal of FKBP8

FKBP8 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal FKBP8 / FKBP38 Antibody (internal region)

APG00543G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FKBP8 / FKBP38 (internal region). This antibody is tested and proven to work in the following applications:

Anti-FKBP8 Antibody

A03722 100ug
EUR 455
Description: Rabbit Polyclonal FKBP8 Antibody. Validated in WB and tested in Human, Mouse, Rat.

FKBP8 Conjugated Antibody

C36485 100ul
EUR 397

anti- FKBP8 antibody

FNab03149 100µg
EUR 585
  • Immunogen: FK506 binding protein 8, 38kDa
  • Uniprot ID: Q14318
  • Gene ID: 23770
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against FKBP8

Anti-FKBP8 antibody

PAab03149 100 ug
EUR 412

Anti-FKBP8 antibody

STJ29165 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody

STJ23669 100 µl
EUR 393
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody

STJ192156 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP8

Fkbp8/ Rat Fkbp8 ELISA Kit

ELI-26710r 96 Tests
EUR 886

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx032679-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx032679-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx233149-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

abx430341-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody

  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FKBP8 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FKBP8 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FKBP8 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FKBP8 / FKBP38 antibody

STJ71583 100 µg
EUR 260

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8)

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8)

FKBP8 Blocking Peptide

33R-3478 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP8 antibody, catalog no. 70R-5950

FKBP8 Blocking Peptide

33R-1277 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSTM2A antibody, catalog no. 70R-5328

FKBP8 cloning plasmid

CSB-CL617913HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atgggacaacccccggcggaggaggctgagcagcctggggccctggcccgagagttccttgctgccatggagcccgagcccgccccagccccggccccagaagagtggctggacattctggggaacgggctgttgaggaagaagacgctggtcccagggccgccaggttcgagcc
  • Show more
Description: A cloning plasmid for the FKBP8 gene.

pET28a-FKBP8 vector

PVT11986 2 ug
EUR 352

pENTR223-FKBP8 vector

PVT12085 2 ug
EUR 308

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

Rat Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit

E0365Ra 1 Kit
EUR 646

Mouse Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit

E0542Mo 1 Kit
EUR 632

Human Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit

abx250535-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human FKBP8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit

E0919Hu 1 Kit
EUR 605

Human FKBP8(Peptidyl-prolyl cis-trans isomerase FKBP8) ELISA Kit

EH1273 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14318
  • Alias: FKBP8/Rotamase/FKBPR38/38 kDa FK506-binding protein/38 kDa FKBP/FKBP-38/hFKBP38/FK506-binding protein 8/FKBP-8/peptidyl-prolyl cis-trans isomerase FKBP8/PPIase FKBP8
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Fkbp8 ELISA Kit| Rat Peptidyl-prolyl cis-trans isomerase FKBP8

EF018697 96 Tests
EUR 689

Mouse Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit

abx515305-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit

abx515306-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Trp93~Asn339)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC-Cy7.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FKBP8 (Gly110~Ser329)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC-Cy7.


ELA-E11198h 96 Tests
EUR 824

Mouse Fkbp8 ELISA KIT

ELI-20815m 96 Tests
EUR 865


ELI-27543h 96 Tests
EUR 824


EF003370 96 Tests
EUR 689

Rat FKBP8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FKBP8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FKBP8 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FKBP8 Rabbit Polyclonal Antibody