FKBP8 Rabbit Polyclonal Antibody

FKBP8 Polyclonal Antibody
ABP58566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FKBP8 protein Applications tips:
Description: A polyclonal antibody for detection of FKBP8 from Human, Mouse, Rat. This FKBP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FKBP8 protein

FKBP8 Polyclonal Antibody
ES10998-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Polyclonal Antibody
ES10998-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against FKBP8 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

FKBP8 Rabbit pAb
A1268-100ul	Abclonal	100 ul	EUR 384

FKBP8 Rabbit pAb
A1268-200ul	Abclonal	200 ul	Ask for price

FKBP8 Rabbit pAb
A1268-20ul	Abclonal	20 ul	Ask for price

FKBP8 Rabbit pAb
A1268-50ul	Abclonal	50 ul	EUR 265

FKBP8 Rabbit pAb
A7085-100ul	Abclonal	100 ul	EUR 308

FKBP8 Rabbit pAb
A7085-200ul	Abclonal	200 ul	EUR 459

FKBP8 Rabbit pAb
A7085-20ul	Abclonal	20 ul	EUR 183

FKBP8 Rabbit pAb
A7085-50ul	Abclonal	50 ul	EUR 223

Polyclonal FKBP8 Antibody (Center)
APR05693G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP8 (Center). This antibody is tested and proven to work in the following applications:

FKBP8 antibody
70R-17315	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FKBP8 antibody

FKBP8 antibody
70R-12792	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal FKBP8 antibody

FKBP8 Antibody
36485-100ul	SAB	100ul	EUR 252

FKBP8 Antibody
1-CSB-PA112026	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FKBP8 Antibody
1-CSB-PA617913LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

FKBP8 Antibody
1-CSB-PA990771	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

FKBP8 antibody
70R-5950	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the N terminal of FKBP8

FKBP8 antibody
70R-5951	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FKBP8 antibody raised against the C terminal of FKBP8

FKBP8 Antibody
1-CSB-PA008704GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal FKBP8 / FKBP38 Antibody (internal region)
APG00543G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FKBP8 / FKBP38 (internal region). This antibody is tested and proven to work in the following applications:

Anti-FKBP8 Antibody
A03722	BosterBio	100ug	EUR 455
Description: Rabbit Polyclonal FKBP8 Antibody. Validated in WB and tested in Human, Mouse, Rat.

FKBP8 Conjugated Antibody
C36485	SAB	100ul	EUR 397

anti- FKBP8 antibody
FNab03149	FN Test	100µg	EUR 585
Immunogen: FK506 binding protein 8, 38kDa Uniprot ID: Q14318 Gene ID: 23770 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against FKBP8

Anti-FKBP8 antibody
PAab03149	Lifescience Market	100 ug	EUR 412

Anti-FKBP8 antibody
STJ29165	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody
STJ23669	St John's Laboratory	100 µl	EUR 393
Description: The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function.

Anti-FKBP8 antibody
STJ192156	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FKBP8

Fkbp8/ Rat Fkbp8 ELISA Kit
ELI-26710r	Lifescience Market	96 Tests	EUR 886

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx005356	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx032679-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx032679-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx233149-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx318140	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
abx430341-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx225175	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody
20-abx001174	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

FKBP8 siRNA
20-abx901978	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FKBP8 siRNA
20-abx916946	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FKBP8 siRNA
20-abx916947	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (HRP)
20-abx315427	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (FITC)
20-abx315428	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Peptidyl-Prolyl Cis-Trans Isomerase FKBP8 (FKBP8) Antibody (Biotin)
20-abx315429	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

FKBP8 Antibody, HRP conjugated
1-CSB-PA617913LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FKBP8 Antibody, FITC conjugated
1-CSB-PA617913LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FKBP8 Antibody, Biotin conjugated
1-CSB-PA617913LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FKBP8. Recognizes FKBP8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FKBP8 / FKBP38 antibody
STJ71583	St John's Laboratory	100 µg	EUR 260

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human)
4-PAE678Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8)

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse)
4-PAE678Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8)

FKBP8 Blocking Peptide
33R-3478	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FKBP8 antibody, catalog no. 70R-5950

FKBP8 Blocking Peptide
33R-1277	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VSTM2A antibody, catalog no. 70R-5328

FKBP8 cloning plasmid
CSB-CL617913HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1068 Sequence: atgggacaacccccggcggaggaggctgagcagcctggggccctggcccgagagttccttgctgccatggagcccgagcccgccccagccccggccccagaagagtggctggacattctggggaacgggctgttgaggaagaagacgctggtcccagggccgccaggttcgagcc Show more
Description: A cloning plasmid for the FKBP8 gene.

pET28a-FKBP8 vector
PVT11986	Lifescience Market	2 ug	EUR 352

pENTR223-FKBP8 vector
PVT12085	Lifescience Market	2 ug	EUR 308

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), APC
4-PAE678Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Biotinylated
4-PAE678Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), Cy3
4-PAE678Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), FITC
4-PAE678Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), HRP
4-PAE678Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Human), PE
4-PAE678Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Trp93~Asn339) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), APC
4-PAE678Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with APC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Biotinylated
4-PAE678Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Biotin.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), Cy3
4-PAE678Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with Cy3.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), FITC
4-PAE678Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with FITC.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), HRP
4-PAE678Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with HRP.

FK506 Binding Protein 8 (FKBP8) Polyclonal Antibody (Mouse), PE
4-PAE678Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FKBP8 (Gly110~Ser329) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse FK506 Binding Protein 8 (FKBP8). This antibody is labeled with PE.

Rat Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit
E0365Ra	Sunlong	1 Kit	EUR 646

Mouse Fkbp8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit
E0542Mo	Sunlong	1 Kit	EUR 632

Human Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit
abx250535-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human FKBP8/ Peptidyl-prolyl cis-trans isomerase FKBP8 ELISA Kit
E0919Hu	Sunlong	1 Kit	EUR 605

Human FKBP8(Peptidyl-prolyl cis-trans isomerase FKBP8) ELISA Kit
EH1273	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q14318 Alias: FKBP8/Rotamase/FKBPR38/38 kDa FK506-binding protein/38 kDa FKBP/FKBP-38/hFKBP38/FK506-binding protein 8/FKBP-8/peptidyl-prolyl cis-trans isomerase FKBP8/PPIase FKBP8
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Fkbp8 ELISA Kit| Rat Peptidyl-prolyl cis-trans isomerase FKBP8
EF018697	Lifescience Market	96 Tests	EUR 689

Mouse Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit
abx515305-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Peptidyl-prolyl cis-trans isomerase FKBP8 (FKBP8) ELISA Kit
abx515306-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx214978	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx102436	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx102437	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx112555	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx131876	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

FK506 Binding Protein 8 (FKBP8) Antibody
20-abx242278	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human FKBP8 ELISA Kit
ELA-E11198h	Lifescience Market	96 Tests	EUR 824

Mouse Fkbp8 ELISA KIT
ELI-20815m	Lifescience Market	96 Tests	EUR 865

Human FKBP8 ELISA KIT
ELI-27543h	Lifescience Market	96 Tests	EUR 824

FKBP8 ELISA KIT|Human
EF003370	Lifescience Market	96 Tests	EUR 689

Rat FKBP8 shRNA Plasmid
20-abx988457	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FKBP8 shRNA Plasmid
20-abx958458	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FKBP8 shRNA Plasmid
20-abx970355	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-His-FKBP8 Plasmid
PVT15950	Lifescience Market	2 ug	EUR 325

FKBP8 Recombinant Protein (Human)
RP012244	ABM	100 ug	Ask for price

FKBP8 Rabbit Polyclonal Antibody