FLRT2 Rabbit Polyclonal Antibody
 FLRT2 Polyclonal Antibody |
|
ABP58572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250
- Applications tips:
|
|
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250 |
FLRT2 Polyclonal Antibody |
|
30115-100ul |
SAB |
100ul |
EUR 252 |
FLRT2 Polyclonal Antibody |
|
30115-50ul |
SAB |
50ul |
EUR 187 |
 FLRT2 Rabbit pAb |
|
A17668-100ul |
Abclonal |
100 ul |
EUR 308 |
FLRT2 Rabbit pAb |
|
A17668-200ul |
Abclonal |
200 ul |
EUR 459 |
FLRT2 Rabbit pAb |
|
A17668-20ul |
Abclonal |
20 ul |
EUR 183 |
FLRT2 Rabbit pAb |
|
A17668-50ul |
Abclonal |
50 ul |
EUR 223 |
 FLRT2 Polyclonal Conjugated Antibody |
|
C30115 |
SAB |
100ul |
EUR 397 |
 Rabbit FLRT2 ELISA Kit |
|
ERTF0109 |
Abclonal |
96Tests |
EUR 521 |
 Anti-FLRT2 antibody |
|
STJ119717 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016] |
Anti-FLRT2 antibody |
|
STJ192439 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to FLRT2 |
 FLRT2 siRNA |
|
20-abx916977 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 FLRT2 cloning plasmid |
|
CSB-CL008730HU-10ug |
Cusabio |
10ug |
EUR 665 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1983
- Sequence: atgggcctacagaccacaaagtggcccagccatggggcttttttcctgaagtcttggcttatcatttccctggggctctactcacaggtgtccaaactcctggcctgccctagtgtgtgccgctgcgacaggaactttgtctactgtaatgagcgaagcttgacctcagtgcctc
- Show more
|
|
Description: A cloning plasmid for the FLRT2 gene. |
 Human FLRT2 ELISA Kit |
|
EHF0109 |
Abclonal |
96Tests |
EUR 521 |
 Goat FLRT2 ELISA Kit |
|
EGTF0109 |
Abclonal |
96Tests |
EUR 521 |
 Canine FLRT2 ELISA Kit |
|
ECF0109 |
Abclonal |
96Tests |
EUR 521 |
 Bovine FLRT2 ELISA Kit |
|
EBF0109 |
Abclonal |
96Tests |
EUR 521 |
 Anserini FLRT2 ELISA Kit |
|
EAF0109 |
Abclonal |
96Tests |
EUR 521 |
 Porcine FLRT2 ELISA Kit |
|
EPF0109 |
Abclonal |
96Tests |
EUR 521 |
 Rat FLRT2 ELISA Kit |
|
ERF0109 |
Abclonal |
96Tests |
EUR 521 |
 Mouse FLRT2 ELISA Kit |
|
EMF0109 |
Abclonal |
96Tests |
EUR 521 |
 Human FLRT2 shRNA Plasmid |
|
20-abx958456 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) FLRT2 Recombinant Protein (Human) |
|
RP039232 |
ABM |
100 ug |
Ask for price |
) FLRT2 Recombinant Protein (Rat) |
|
RP201539 |
ABM |
100 ug |
Ask for price |
) FLRT2 Recombinant Protein (Mouse) |
|
RP134801 |
ABM |
100 ug |
Ask for price |
 Polyclonal Antibody (Human)) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human) |
|
4-PAC481Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) |
 Polyclonal Antibody (Human), APC) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC |
|
4-PAC481Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAC481Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Cy3 |
|
4-PAC481Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), FITC |
|
4-PAC481Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), HRP |
|
4-PAC481Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), PE |
|
4-PAC481Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with PE. |
 Human FLRT2 PicoKine ELISA Kit |
|
EK1971 |
BosterBio |
96 wells |
EUR 425 |
|
Description: For quantitative detection of human FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
 Mouse FLRT2 PicoKine ELISA Kit |
|
EK1972 |
BosterBio |
96 wells |
EUR 425 |
|
Description: For quantitative detection of mouse FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
 Rat FLRT2 PicoKine ELISA Kit |
|
EK1973 |
BosterBio |
96 wells |
EUR 425 |
|
Description: For quantitative detection of rat FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA). |
 Guinea Pig FLRT2 ELISA Kit |
|
EGF0109 |
Abclonal |
96Tests |
EUR 521 |
 (pORF)) Flrt2 ORF Vector (Rat) (pORF) |
|
ORF067181 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Flrt2 ORF Vector (Mouse) (pORF) |
|
ORF044935 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) FLRT2 ORF Vector (Human) (pORF) |
|
ORF013078 |
ABM |
1.0 ug DNA |
EUR 354 |
 ELISA Kit) Rabbit Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) ELISA Kit |
|
abx362800-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAC481Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: FLRT2 (Ser300~Ser517)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC-Cy7. |
 Antibody) Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Antibody |
|
20-abx131259 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) FLRT2 sgRNA CRISPR Lentivector set (Human) |
|
K0787901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Flrt2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4147701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Flrt2 sgRNA CRISPR Lentivector set (Rat) |
|
K6636201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) FLRT2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0787902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) FLRT2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0787903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) FLRT2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0787904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4147702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4147703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4147704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6636202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6636203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6636204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) FLRT2 Protein Vector (Human) (pPB-C-His) |
|
PV052309 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) FLRT2 Protein Vector (Human) (pPB-N-His) |
|
PV052310 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) FLRT2 Protein Vector (Human) (pPM-C-HA) |
|
PV052311 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) FLRT2 Protein Vector (Human) (pPM-C-His) |
|
PV052312 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) FLRT2 Protein Vector (Rat) (pPB-C-His) |
|
PV268722 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) FLRT2 Protein Vector (Rat) (pPB-N-His) |
|
PV268723 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) FLRT2 Protein Vector (Rat) (pPM-C-HA) |
|
PV268724 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) FLRT2 Protein Vector (Rat) (pPM-C-His) |
|
PV268725 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) FLRT2 Protein Vector (Mouse) (pPB-C-His) |
|
PV179738 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) FLRT2 Protein Vector (Mouse) (pPB-N-His) |
|
PV179739 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) FLRT2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV179740 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) FLRT2 Protein Vector (Mouse) (pPM-C-His) |
|
PV179741 |
ABM |
500 ng |
EUR 603 |
 Flrt2 3'UTR Luciferase Stable Cell Line |
|
TU204683 |
ABM |
1.0 ml |
Ask for price |
 Flrt2 3'UTR GFP Stable Cell Line |
|
TU156621 |
ABM |
1.0 ml |
Ask for price |
 FLRT2 3'UTR Luciferase Stable Cell Line |
|
TU008026 |
ABM |
1.0 ml |
EUR 2333 |
Flrt2 3'UTR Luciferase Stable Cell Line |
|
TU106621 |
ABM |
1.0 ml |
Ask for price |
 FLRT2 3'UTR GFP Stable Cell Line |
|
TU058026 |
ABM |
1.0 ml |
EUR 2333 |
Flrt2 3'UTR GFP Stable Cell Line |
|
TU254683 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) FLRT2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV649033 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) FLRT2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV649037 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) FLRT2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV649038 |
ABM |
1.0 ug DNA |
EUR 682 |
 Recombinant human Leucine-rich repeat transmembrane protein FLRT2 |
|
P1409 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: O43155
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
|
Description: Recombinant protein for human Leucine-rich repeat transmembrane protein FLRT2 |
) Recombinant Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) |
|
4-RPC481Hu01 |
Cloud-Clone |
-
EUR 352.67
-
EUR 197.00
-
EUR 1047.52
-
EUR 415.84
-
EUR 731.68
-
EUR 299.00
-
EUR 2468.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43155
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 28.0kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Fibronectin Leucine Rich Transmembrane Protein 2 expressed in: E.coli |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
FLRT2 Rabbit Polyclonal Antibody
