FLRT2 Rabbit Polyclonal Antibody

FLRT2 Polyclonal Antibody
ABP58572-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of FLRT2 from Human. This FLRT2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FLRT2 protein at amino acid sequence of 170-250

FLRT2 Polyclonal Antibody
30115-100ul	SAB	100ul	EUR 252

FLRT2 Polyclonal Antibody
30115-50ul	SAB	50ul	EUR 187

FLRT2 Rabbit pAb
A17668-100ul	Abclonal	100 ul	EUR 308

FLRT2 Rabbit pAb
A17668-200ul	Abclonal	200 ul	EUR 459

FLRT2 Rabbit pAb
A17668-20ul	Abclonal	20 ul	EUR 183

FLRT2 Rabbit pAb
A17668-50ul	Abclonal	50 ul	EUR 223

FLRT2 Polyclonal Conjugated Antibody
C30115	SAB	100ul	EUR 397

Rabbit FLRT2 ELISA Kit
ERTF0109	Abclonal	96Tests	EUR 521

Anti-FLRT2 antibody
STJ119717	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]

Anti-FLRT2 antibody
STJ192439	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FLRT2

FLRT2 siRNA
20-abx916977	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FLRT2 cloning plasmid
CSB-CL008730HU-10ug	Cusabio	10ug	EUR 665
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1983 Sequence: atgggcctacagaccacaaagtggcccagccatggggcttttttcctgaagtcttggcttatcatttccctggggctctactcacaggtgtccaaactcctggcctgccctagtgtgtgccgctgcgacaggaactttgtctactgtaatgagcgaagcttgacctcagtgcctc Show more
Description: A cloning plasmid for the FLRT2 gene.

Human FLRT2 ELISA Kit
EHF0109	Abclonal	96Tests	EUR 521

Goat FLRT2 ELISA Kit
EGTF0109	Abclonal	96Tests	EUR 521

Canine FLRT2 ELISA Kit
ECF0109	Abclonal	96Tests	EUR 521

Bovine FLRT2 ELISA Kit
EBF0109	Abclonal	96Tests	EUR 521

Anserini FLRT2 ELISA Kit
EAF0109	Abclonal	96Tests	EUR 521

Human FLRT2 ELISA KIT
ELI-09849h	Lifescience Market	96 Tests	EUR 824

Porcine FLRT2 ELISA Kit
EPF0109	Abclonal	96Tests	EUR 521

Rat FLRT2 ELISA Kit
ERF0109	Abclonal	96Tests	EUR 521

Mouse FLRT2 ELISA Kit
EMF0109	Abclonal	96Tests	EUR 521

Human FLRT2 shRNA Plasmid
20-abx958456	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FLRT2 Recombinant Protein (Human)
RP039232	ABM	100 ug	Ask for price

FLRT2 Recombinant Protein (Rat)
RP201539	ABM	100 ug	Ask for price

FLRT2 Recombinant Protein (Mouse)
RP134801	ABM	100 ug	Ask for price

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human)
4-PAC481Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2)

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC
4-PAC481Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Biotinylated
4-PAC481Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Biotin.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), Cy3
4-PAC481Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with Cy3.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), FITC
4-PAC481Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with FITC.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), HRP
4-PAC481Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with HRP.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), PE
4-PAC481Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with PE.

Human FLRT2 PicoKine ELISA Kit
EK1971	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse FLRT2 PicoKine ELISA Kit
EK1972	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA).

Rat FLRT2 PicoKine ELISA Kit
EK1973	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat FLRT2 in cell culture supernates, serum and plasma (heparin, EDTA).

Guinea Pig FLRT2 ELISA Kit
EGF0109	Abclonal	96Tests	EUR 521

Flrt2 ORF Vector (Rat) (pORF)
ORF067181	ABM	1.0 ug DNA	EUR 506

Flrt2 ORF Vector (Mouse) (pORF)
ORF044935	ABM	1.0 ug DNA	EUR 506

FLRT2 ORF Vector (Human) (pORF)
ORF013078	ABM	1.0 ug DNA	EUR 354

FLRT2 ELISA Kit (Human) (OKBB01345)
OKBB01345	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 14q31.3. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Flrt2 ELISA Kit (Mouse) (OKBB01346)
OKBB01346	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 12; 12 E. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Flrt2 ELISA Kit (Rat) (OKBB01347)
OKBB01347	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Fibronectin leucine-rich repeat transmembrane protein FLRT2 is a protein that in humans is encoded by the FLRT2 gene. It is mapped to 6q31. This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FLRT2 ELISA Kit (Human) (OKCA01329)
OKCA01329	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells. May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 23.44 pg/mL

FLRT2 ELISA Kit (Mouse) (OKEI00453)
OKEI00453	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells . May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D . Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members . Plays a role in fibroblast growth factor-mediated signaling cascades . Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis .;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.875 ng/mL

FLRT2 ELISA Kit (Rat) (OKEI00767)
OKEI00767	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Functions in cell-cell adhesion, cell migration and axon guidance. Mediates cell-cell adhesion via its interactions with ADGRL3 and probably also other latrophilins that are expressed at the surface of adjacent cells. May play a role in the migration of cortical neurons during brain development via its interaction with UNC5D. Mediates axon growth cone collapse and plays a repulsive role in neuron guidance via its interaction with UNC5D, and possibly also other UNC-5 family members. Plays a role in fibroblast growth factor-mediated signaling cascades. Required for normal organization of the cardiac basement membrane during embryogenesis, and for normal embryonic epicardium and heart morphogenesis.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Rabbit Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) ELISA Kit
abx362800-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Polyclonal Antibody (Human), APC-Cy7
4-PAC481Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FLRT2 (Ser300~Ser517) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2). This antibody is labeled with APC-Cy7.

Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2) Antibody
20-abx131259	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

FLRT2 sgRNA CRISPR Lentivector set (Human)
K0787901	ABM	3 x 1.0 ug	EUR 339

Flrt2 sgRNA CRISPR Lentivector set (Mouse)
K4147701	ABM	3 x 1.0 ug	EUR 339

Flrt2 sgRNA CRISPR Lentivector set (Rat)
K6636201	ABM	3 x 1.0 ug	EUR 339

FLRT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0787902	ABM	1.0 ug DNA	EUR 154

FLRT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0787903	ABM	1.0 ug DNA	EUR 154

FLRT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0787904	ABM	1.0 ug DNA	EUR 154

Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4147702	ABM	1.0 ug DNA	EUR 154

Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4147703	ABM	1.0 ug DNA	EUR 154

Flrt2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4147704	ABM	1.0 ug DNA	EUR 154

Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6636202	ABM	1.0 ug DNA	EUR 154

Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6636203	ABM	1.0 ug DNA	EUR 154

Flrt2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6636204	ABM	1.0 ug DNA	EUR 154

FLRT2 Protein Vector (Human) (pPB-C-His)
PV052309	ABM	500 ng	EUR 481

FLRT2 Protein Vector (Human) (pPB-N-His)
PV052310	ABM	500 ng	EUR 481

FLRT2 Protein Vector (Human) (pPM-C-HA)
PV052311	ABM	500 ng	EUR 481

FLRT2 Protein Vector (Human) (pPM-C-His)
PV052312	ABM	500 ng	EUR 481

FLRT2 Protein Vector (Rat) (pPB-C-His)
PV268722	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Rat) (pPB-N-His)
PV268723	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Rat) (pPM-C-HA)
PV268724	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Rat) (pPM-C-His)
PV268725	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Mouse) (pPB-C-His)
PV179738	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Mouse) (pPB-N-His)
PV179739	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Mouse) (pPM-C-HA)
PV179740	ABM	500 ng	EUR 603

FLRT2 Protein Vector (Mouse) (pPM-C-His)
PV179741	ABM	500 ng	EUR 603

Flrt2 3'UTR Luciferase Stable Cell Line
TU204683	ABM	1.0 ml	Ask for price

Flrt2 3'UTR GFP Stable Cell Line
TU156621	ABM	1.0 ml	Ask for price

FLRT2 3'UTR Luciferase Stable Cell Line
TU008026	ABM	1.0 ml	EUR 2333

Flrt2 3'UTR Luciferase Stable Cell Line
TU106621	ABM	1.0 ml	Ask for price

FLRT2 3'UTR GFP Stable Cell Line
TU058026	ABM	1.0 ml	EUR 2333

Flrt2 3'UTR GFP Stable Cell Line
TU254683	ABM	1.0 ml	Ask for price

FLRT2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV649033	ABM	1.0 ug DNA	EUR 682

FLRT2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV649037	ABM	1.0 ug DNA	EUR 682

FLRT2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV649038	ABM	1.0 ug DNA	EUR 682

Recombinant human Leucine-rich repeat transmembrane protein FLRT2
P1409	FN Test	100ug	Ask for price
Uniprot ID: O43155 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Leucine-rich repeat transmembrane protein FLRT2

Recombinant Fibronectin Leucine Rich Transmembrane Protein 2 (FLRT2)
4-RPC481Hu01	Cloud-Clone	EUR 352.67 EUR 197.00 EUR 1047.52 EUR 415.84 EUR 731.68 EUR 299.00 EUR 2468.80	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O43155 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Fibronectin Leucine Rich Transmembrane Protein 2 expressed in: E.coli

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

FLRT2 Rabbit Polyclonal Antibody