FOXC2 Rabbit Polyclonal Antibody

FOXC2 Antibody
36862-100ul	SAB	100ul	EUR 252

FOXC2 Antibody
1-CSB-PA955638	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FOXC2 Antibody
1-CSB-PA975779	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

FOXC2 Antibody
1-CSB-PA857880LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rabbit FoxC2 ELISA Kit
ERTF0027	Abclonal	96Tests	EUR 521

Polyclonal Goat Anti-FOXC2 Antibody
AMM04978G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FOXC2 . This antibody is tested and proven to work in the following applications:

Polyclonal Foxc2 antibody - N-terminal region
APR00773G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Foxc2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal FOXC2 antibody - C-terminal region
AMM04599G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FOXC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

FOXC2 Conjugated Antibody
C36862	SAB	100ul	EUR 397

anti- FOXC2 antibody
FNab03191	FN Test	100µg	EUR 505.25
Immunogen: forkhead box C2(MFH-1, mesenchyme forkhead 1) Uniprot ID: Q99958 Gene ID: 2303 Research Area: Epigenetics, Signal Transduction, Metabolism, Developmental biology, Neuroscience
Description: Antibody raised against FOXC2

FOXC1 / FOXC2 Antibody
20-abx329537	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

FOXC1/FOXC2 Antibody
1-CSB-PA008290	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FOXC1/FOXC2. Recognizes FOXC1/FOXC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

Anti-FOXC2 antibody
PAab03191	Lifescience Market	100 ug	EUR 355

Anti-FOXC2 antibody
STJ70385	St John's Laboratory	100 µg	EUR 359

Anti-FOXC2 antibody
STJ192155	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to FOXC2

Foxc2/ Rat Foxc2 ELISA Kit
ELI-30871r	Lifescience Market	96 Tests	EUR 886

FOXC2 siRNA
20-abx902004	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FOXC2 siRNA
20-abx917093	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FOXC2 siRNA
20-abx917094	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FOXC2 Antibody, HRP conjugated
1-CSB-PA857880LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FOXC2 Antibody, FITC conjugated
1-CSB-PA857880LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FOXC2 Antibody, Biotin conjugated
1-CSB-PA857880LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FOXC2. Recognizes FOXC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Goat Anti Human Foxc2 (C-Terminal) Polyclonal Antibody
CPBT-67491GH	Creative Diagnostics	0.1 mg	EUR 840

FOXC2 cloning plasmid
CSB-CL857880HU-10ug	Cusabio	10ug	EUR 531
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1506 Sequence: ATGCAGGCGCGCTACTCCGTGTCCGACCCCAACGCCCTGGGAGTGGTGCCCTACCTGAGCGAGCAGAATTACTACCGGGCTGCGGGCAGCTACGGCGGCATGGCCAGCCCCATGGGCGTCTATTCCGGCCACCCGGAGCAGTACAGCGCGGGGATGGGCCGCTCCTACGCGCCCT Show more
Description: A cloning plasmid for the FOXC2 gene.

Anti-FOXC2 (3H3)
YF-MA13050	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3H3)
YF-MA13051	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (2H3)
YF-MA13052	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (4B3)
YF-MA13053	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (1A8)
YF-MA13054	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3H5)
YF-MA13055	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3E6)
YF-MA13056	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (4A5)
YF-MA13057	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (4A3)
YF-MA13058	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (1D4)
YF-MA13059	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Anti-FOXC2 (3D6)
YF-MA20189	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to FOXC2

Monoclonal FOXC2 Antibody, Clone: 1D11C8
AMM04595G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human FOXC2. The antibodies are raised in Mouse and are from clone 1D11C8. This antibody is applicable in WB, E

Monoclonal FOXC2 Antibody, Clone: 1D11C8
AMM04596G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human FOXC2. The antibodies are raised in Mouse and are from clone 1D11C8. This antibody is applicable in WB, E

Forkhead Box Protein C2 (FOXC2) Antibody
abx015862-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
abx015863-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
abx431254-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
20-abx242341	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
20-abx242342	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
20-abx301856	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody
abx233191-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Rat FOXC2 shRNA Plasmid
20-abx987740	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FoxC2 ELISA Kit
EHF0027	Abclonal	96Tests	EUR 521

Human FOXC2 ELISA Kit
ELA-E12449h	Lifescience Market	96 Tests	EUR 824

Goat FoxC2 ELISA Kit
EGTF0027	Abclonal	96Tests	EUR 521

Canine FoxC2 ELISA Kit
ECF0027	Abclonal	96Tests	EUR 521

Bovine FoxC2 ELISA Kit
EBF0027	Abclonal	96Tests	EUR 521

Anserini FoxC2 ELISA Kit
EAF0027	Abclonal	96Tests	EUR 521

FOXC2 ELISA KIT|Human
EF004777	Lifescience Market	96 Tests	EUR 689

Porcine FoxC2 ELISA Kit
EPF0027	Abclonal	96Tests	EUR 521

Rat FoxC2 ELISA Kit
ERF0027	Abclonal	96Tests	EUR 521

Mouse FoxC2 ELISA Kit
EMF0027	Abclonal	96Tests	EUR 521

Mouse FOXC2 shRNA Plasmid
20-abx970357	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human FOXC2 shRNA Plasmid
20-abx951610	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FOXC2 Recombinant Protein (Human)
RP039259	ABM	100 ug	Ask for price

pCR4-TOPO-foxc2 Plasmid
PVTB00241S	Lifescience Market	2 ug	EUR 356

FOXC2 Recombinant Protein (Rat)
RP201671	ABM	100 ug	Ask for price

FOXC2 Recombinant Protein (Mouse)
RP135026	ABM	100 ug	Ask for price

Monoclonal FOXC2 Antibody (monoclonal) (M02), Clone: 2H3
AMM04597G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human FOXC2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2H3. This antibody is applicable in WB, IHC and IF, E

Monoclonal FOXC2 Antibody (monoclonal) (M03), Clone: 4B3
AMM04598G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human FOXC2 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B3. This antibody is applicable in WB, E

Forkhead Box Protein C2 (FOXC2) Antibody (HRP)
20-abx316492	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody (FITC)
20-abx316493	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Forkhead Box Protein C2 (FOXC2) Antibody (Biotin)
20-abx316494	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Guinea Pig FoxC2 ELISA Kit
EGF0027	Abclonal	96Tests	EUR 521

Foxc2 ORF Vector (Rat) (pORF)
ORF067225	ABM	1.0 ug DNA	EUR 506

Foxc2 ORF Vector (Mouse) (pORF)
ORF045010	ABM	1.0 ug DNA	EUR 506

FOXC2 ORF Vector (Human) (pORF)
ORF013087	ABM	1.0 ug DNA	EUR 95

Human Forkhead box C2（FOXC2）
QY-E05307	Qayee Biotechnology	96T	EUR 394

FOXC2 ELISA Kit (Mouse) (OKEH05599)
OKEH05599	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Transcriptional activator. Might be involved in the formation of special mesenchymal tissues.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.09 ng/mL

FOXC2 sgRNA CRISPR Lentivector set (Human)
K0795201	ABM	3 x 1.0 ug	EUR 339

Foxc2 sgRNA CRISPR Lentivector set (Mouse)
K5011901	ABM	3 x 1.0 ug	EUR 339

Foxc2 sgRNA CRISPR Lentivector set (Rat)
K7110801	ABM	3 x 1.0 ug	EUR 339

FOXC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0795202	ABM	1.0 ug DNA	EUR 154

FOXC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0795203	ABM	1.0 ug DNA	EUR 154

FOXC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0795204	ABM	1.0 ug DNA	EUR 154

Foxc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5011902	ABM	1.0 ug DNA	EUR 154

Foxc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5011903	ABM	1.0 ug DNA	EUR 154

Foxc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5011904	ABM	1.0 ug DNA	EUR 154

Foxc2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7110802	ABM	1.0 ug DNA	EUR 154

Foxc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7110803	ABM	1.0 ug DNA	EUR 154

Foxc2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7110804	ABM	1.0 ug DNA	EUR 154

FOXC2 Protein Vector (Human) (pPB-C-His)
PV052345	ABM	500 ng	EUR 481

FOXC2 Protein Vector (Human) (pPB-N-His)
PV052346	ABM	500 ng	EUR 481

FOXC2 Protein Vector (Human) (pPM-C-HA)
PV052347	ABM	500 ng	EUR 481

FOXC2 Protein Vector (Human) (pPM-C-His)
PV052348	ABM	500 ng	EUR 481

FOXC2 Protein Vector (Rat) (pPB-C-His)
PV268898	ABM	500 ng	EUR 603

FOXC2 Rabbit Polyclonal Antibody