FXYD5 Rabbit Polyclonal Antibody
FXYD5 Polyclonal Antibody |
ABP58599-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
- Applications tips:
|
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal |
FXYD5 Polyclonal Antibody |
ABP58599-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
- Applications tips:
|
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal |
FXYD5 Polyclonal Antibody |
ABP58599-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
- Applications tips:
|
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal |
FXYD5 Antibody |
20-abx320750 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FXYD5 antibody |
70R-6056 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FXYD5 antibody raised against the middle region of FXYD5 |
FXYD5 antibody |
70R-17379 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FXYD5 antibody |
FXYD5 antibody |
70R-14302 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal FXYD5 antibody |
FXYD5 antibody |
70R-1682 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal FXYD5 antibody raised against the N terminal of FXYD5 |
FXYD5 antibody |
70R-1683 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal FXYD5 antibody raised against the middle region of FXYD5 |
FXYD5 Antibody |
1-CSB-PA842655DSR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against FXYD5. Recognizes FXYD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
FXYD5 Antibody |
1-CSB-PA009093GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against FXYD5. Recognizes FXYD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Anti-FXYD5 antibody |
STJ192528 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FXYD5 |
FXYD5 siRNA |
20-abx902042 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FXYD5 Protein |
20-abx261022 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
FXYD5 siRNA |
20-abx917342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FXYD5 siRNA |
20-abx917343 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Dysadherin/FXYD5 Antibody |
PA1765 |
BosterBio |
100ug/vial |
EUR 334 |
FXYD5 Blocking Peptide |
33R-5326 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-1682 |
FXYD5 Blocking Peptide |
33R-1922 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-1683 |
FXYD5 Blocking Peptide |
33R-8401 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-6056 |
FXYD5 cloning plasmid |
CSB-CL842655HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: atgtcgccctctggtcgcctgtgtcttcttaccatcgttggcctgattctccccaccagaggacagacgttgaaagataccacgtccagttcttcagcagactcaactatcatggacattcaggtcccgacacgagccccagatgcagtctacacagaactccagcccacctctcc
- Show more
|
Description: A cloning plasmid for the FXYD5 gene. |
Rat FXYD5 shRNA Plasmid |
20-abx986018 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FXYD5 shRNA Plasmid |
20-abx959983 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FXYD5 protein (His tag) |
80R-2672 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Purified recombinant FXYD5 protein (His tag) |
Mouse FXYD5 shRNA Plasmid |
20-abx971863 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FXYD5 Recombinant Protein (Human) |
RP012706 |
ABM |
100 ug |
Ask for price |
FXYD5 Human Recombinant Protein |
PROTQ96DB9 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: FXYD5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 147 amino acids (22-145 a.a) and having a molecular mass of 16.1kDa. FXYD5 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
FXYD5 Recombinant Protein (Rat) |
RP201938 |
ABM |
100 ug |
Ask for price |
FXYD5 Recombinant Protein (Mouse) |
RP135503 |
ABM |
100 ug |
Ask for price |
FXYD5 Recombinant Protein (Mouse) |
RP135506 |
ABM |
100 ug |
Ask for price |
Human Dysadherin (FXYD5) ELISA Kit |
abx259551-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
FXYD5 ORF Vector (Human) (pORF) |
ORF004236 |
ABM |
1.0 ug DNA |
EUR 95 |
Fxyd5 ORF Vector (Rat) (pORF) |
ORF067314 |
ABM |
1.0 ug DNA |
EUR 506 |
Fxyd5 ORF Vector (Mouse) (pORF) |
ORF045169 |
ABM |
1.0 ug DNA |
EUR 506 |
Fxyd5 ORF Vector (Mouse) (pORF) |
ORF045170 |
ABM |
1.0 ug DNA |
EUR 506 |
FXYD5 ELISA Kit (Human) (OKCA00678) |
OKCA00678 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.75 pg/mL |
FXYD5 ELISA Kit (Mouse) (OKCA01669) |
OKCA01669 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL |
FXYD5 sgRNA CRISPR Lentivector set (Human) |
K0824301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fxyd5 sgRNA CRISPR Lentivector set (Mouse) |
K3958201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fxyd5 sgRNA CRISPR Lentivector set (Rat) |
K6799401 |
ABM |
3 x 1.0 ug |
EUR 339 |
FXYD5 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0824302 |
ABM |
1.0 ug DNA |
EUR 154 |
FXYD5 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0824303 |
ABM |
1.0 ug DNA |
EUR 154 |
FXYD5 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0824304 |
ABM |
1.0 ug DNA |
EUR 154 |
Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3958202 |
ABM |
1.0 ug DNA |
EUR 154 |
Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3958203 |
ABM |
1.0 ug DNA |
EUR 154 |
Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3958204 |
ABM |
1.0 ug DNA |
EUR 154 |
Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6799402 |
ABM |
1.0 ug DNA |
EUR 154 |
Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6799403 |
ABM |
1.0 ug DNA |
EUR 154 |
Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6799404 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human FXYD5 Protein, His, E.coli-1mg |
QP11913-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human FXYD5 Protein, His, E.coli-20ug |
QP11913-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human FXYD5 Protein, His, E.coli-5ug |
QP11913-5ug |
EnQuireBio |
5ug |
EUR 155 |
FXYD5 Protein Vector (Rat) (pPB-C-His) |
PV269254 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Rat) (pPB-N-His) |
PV269255 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Rat) (pPM-C-HA) |
PV269256 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Rat) (pPM-C-His) |
PV269257 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPB-C-His) |
PV180674 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPB-N-His) |
PV180675 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPM-C-HA) |
PV180676 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPM-C-His) |
PV180677 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPB-C-His) |
PV180678 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPB-N-His) |
PV180679 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPM-C-HA) |
PV180680 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Mouse) (pPM-C-His) |
PV180681 |
ABM |
500 ng |
EUR 603 |
FXYD5 Protein Vector (Human) (pPB-C-His) |
PV016941 |
ABM |
500 ng |
EUR 329 |
FXYD5 Protein Vector (Human) (pPB-N-His) |
PV016942 |
ABM |
500 ng |
EUR 329 |
FXYD5 Protein Vector (Human) (pPM-C-HA) |
PV016943 |
ABM |
500 ng |
EUR 329 |
FXYD5 Protein Vector (Human) (pPM-C-His) |
PV016944 |
ABM |
500 ng |
EUR 329 |
Fxyd5 3'UTR Luciferase Stable Cell Line |
TU204848 |
ABM |
1.0 ml |
Ask for price |
Fxyd5 3'UTR GFP Stable Cell Line |
TU156801 |
ABM |
1.0 ml |
Ask for price |
FXYD5 3'UTR Luciferase Stable Cell Line |
TU008411 |
ABM |
1.0 ml |
EUR 1394 |
Fxyd5 3'UTR Luciferase Stable Cell Line |
TU106801 |
ABM |
1.0 ml |
Ask for price |
FXYD5 3'UTR GFP Stable Cell Line |
TU058411 |
ABM |
1.0 ml |
EUR 1394 |
Fxyd5 3'UTR GFP Stable Cell Line |
TU254848 |
ABM |
1.0 ml |
Ask for price |
Anti-FXYD5 (clone M53)-PEG-cardiac glycoside ADC |
ADC-W-079 |
Creative Biolabs |
1mg |
Ask for price |
Description: This ADC product is comprised of an anti-FXYD5 monoclonal antibody (clone M53) conjugated via a PEG linker to cardiac glycoside |
FXYD5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV670441 |
ABM |
1.0 ug DNA |
EUR 514 |
FXYD5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV670445 |
ABM |
1.0 ug DNA |
EUR 514 |
FXYD5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV670446 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
FXYD5 Rabbit Polyclonal Antibody