셀타젠 Genetic Genotyping

FXYD5 Rabbit Polyclonal Antibody

FXYD5 Polyclonal Antibody

ABP58599-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
  • Applications tips:
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal

FXYD5 Polyclonal Antibody

ES11370-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FXYD5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FXYD5 Polyclonal Antibody

ES11370-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FXYD5 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

FXYD5 antibody

70R-1682 100 ug
EUR 377
Description: Rabbit polyclonal FXYD5 antibody raised against the N terminal of FXYD5

FXYD5 antibody

70R-1683 100 ug
EUR 377
Description: Rabbit polyclonal FXYD5 antibody raised against the middle region of FXYD5

FXYD5 antibody

70R-17379 50 ul
EUR 435
Description: Rabbit polyclonal FXYD5 antibody

FXYD5 antibody

70R-14302 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FXYD5 antibody

FXYD5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FXYD5. Recognizes FXYD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FXYD5 antibody

70R-6056 50 ug
EUR 467
Description: Rabbit polyclonal FXYD5 antibody raised against the middle region of FXYD5

FXYD5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FXYD5. Recognizes FXYD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FXYD5 Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fxyd5/ Rat Fxyd5 ELISA Kit

ELI-48338r 96 Tests
EUR 886

Anti-FXYD5 antibody

STJ192528 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FXYD5

FXYD5 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Dysadherin/FXYD5 Antibody

PA1765 100ug/vial
EUR 334

FXYD5 Blocking Peptide

33R-1922 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-1683

FXYD5 Blocking Peptide

33R-5326 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-1682

FXYD5 Blocking Peptide

33R-8401 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-6056

FXYD5 cloning plasmid

CSB-CL842655HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgtcgccctctggtcgcctgtgtcttcttaccatcgttggcctgattctccccaccagaggacagacgttgaaagataccacgtccagttcttcagcagactcaactatcatggacattcaggtcccgacacgagccccagatgcagtctacacagaactccagcccacctctcc
  • Show more
Description: A cloning plasmid for the FXYD5 gene.

FXYD5 protein (His tag)

80R-2672 100 ug
EUR 349
Description: Purified recombinant FXYD5 protein (His tag)

Mouse FXYD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FXYD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FXYD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Fxyd5 ELISA KIT

ELI-32547m 96 Tests
EUR 865


ELI-37592h 96 Tests
EUR 824

FXYD5 Human Recombinant Protein

PROTQ96DB9 Regular: 20ug
EUR 317
Description: FXYD5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 147 amino acids (22-145 a.a) and having a molecular mass of 16.1kDa. FXYD5 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

FXYD5 Recombinant Protein (Human)

RP012706 100 ug Ask for price

FXYD5 Recombinant Protein (Rat)

RP201938 100 ug Ask for price

FXYD5 Recombinant Protein (Mouse)

RP135503 100 ug Ask for price

FXYD5 Recombinant Protein (Mouse)

RP135506 100 ug Ask for price

Human Dysadherin (FXYD5) ELISA Kit

abx259551-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Fxyd5 ORF Vector (Rat) (pORF)

ORF067314 1.0 ug DNA
EUR 506

FXYD5 ORF Vector (Human) (pORF)

ORF004236 1.0 ug DNA
EUR 95

Fxyd5 ORF Vector (Mouse) (pORF)

ORF045169 1.0 ug DNA
EUR 506

Fxyd5 ORF Vector (Mouse) (pORF)

ORF045170 1.0 ug DNA
EUR 506

FXYD5 ELISA Kit (Human) (OKCA00678)

OKCA00678 96 Wells
EUR 833
Description: Description of target: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.75 pg/mL

FXYD5 ELISA Kit (Mouse) (OKCA01669)

OKCA01669 96 Wells
EUR 846
Description: Description of target: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

Fxyd5 sgRNA CRISPR Lentivector set (Rat)

K6799401 3 x 1.0 ug
EUR 339

FXYD5 sgRNA CRISPR Lentivector set (Human)

K0824301 3 x 1.0 ug
EUR 339

Fxyd5 sgRNA CRISPR Lentivector set (Mouse)

K3958201 3 x 1.0 ug
EUR 339

Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6799402 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6799403 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6799404 1.0 ug DNA
EUR 154

FXYD5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0824302 1.0 ug DNA
EUR 154

FXYD5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0824303 1.0 ug DNA
EUR 154

FXYD5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0824304 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3958202 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3958203 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3958204 1.0 ug DNA
EUR 154

FXYD5 Protein Vector (Rat) (pPB-C-His)

PV269254 500 ng
EUR 603

FXYD5 Protein Vector (Rat) (pPB-N-His)

PV269255 500 ng
EUR 603

FXYD5 Protein Vector (Rat) (pPM-C-HA)

PV269256 500 ng
EUR 603

FXYD5 Protein Vector (Rat) (pPM-C-His)

PV269257 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-C-His)

PV180674 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-N-His)

PV180675 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-HA)

PV180676 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-His)

PV180677 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-C-His)

PV180678 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-N-His)

PV180679 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-HA)

PV180680 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-His)

PV180681 500 ng
EUR 603

FXYD5 Protein Vector (Human) (pPB-C-His)

PV016941 500 ng
EUR 329

FXYD5 Protein Vector (Human) (pPB-N-His)

PV016942 500 ng
EUR 329

FXYD5 Protein Vector (Human) (pPM-C-HA)

PV016943 500 ng
EUR 329

FXYD5 Protein Vector (Human) (pPM-C-His)

PV016944 500 ng
EUR 329

Recombinant Human FXYD5 Protein, His, E.coli-1mg

QP11913-1mg 1mg
EUR 2757

Recombinant Human FXYD5 Protein, His, E.coli-20ug

QP11913-20ug 20ug
EUR 201

Recombinant Human FXYD5 Protein, His, E.coli-5ug

QP11913-5ug 5ug
EUR 155

Fxyd5 3'UTR GFP Stable Cell Line

TU156801 1.0 ml Ask for price

Fxyd5 3'UTR Luciferase Stable Cell Line

TU106801 1.0 ml Ask for price

Fxyd5 3'UTR Luciferase Stable Cell Line

TU204848 1.0 ml Ask for price

Fxyd5 3'UTR GFP Stable Cell Line

TU254848 1.0 ml Ask for price

FXYD5 3'UTR GFP Stable Cell Line

TU058411 1.0 ml
EUR 1394

FXYD5 3'UTR Luciferase Stable Cell Line

TU008411 1.0 ml
EUR 1394

Anti-FXYD5 (clone M53)-PEG-cardiac glycoside ADC

ADC-W-079 1mg Ask for price
Description: This ADC product is comprised of an anti-FXYD5 monoclonal antibody (clone M53) conjugated via a PEG linker to cardiac glycoside

FXYD5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV670441 1.0 ug DNA
EUR 514

FXYD5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV670445 1.0 ug DNA
EUR 514

FXYD5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV670446 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

FXYD5 Rabbit Polyclonal Antibody