셀타젠 Genetic Genotyping

FXYD5 Rabbit Polyclonal Antibody

FXYD5 Polyclonal Antibody

ABP58599-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
  • Applications tips:
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal

FXYD5 Polyclonal Antibody

ABP58599-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
  • Applications tips:
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal

FXYD5 Polyclonal Antibody

ABP58599-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal
  • Applications tips:
Description: A polyclonal antibody for detection of FXYD5 from Human. This FXYD5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FXYD5 protein at amino acid sequence of Internal

FXYD5 Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

FXYD5 antibody

70R-6056 50 ug
EUR 467
Description: Rabbit polyclonal FXYD5 antibody raised against the middle region of FXYD5

FXYD5 antibody

70R-17379 50 ul
EUR 435
Description: Rabbit polyclonal FXYD5 antibody

FXYD5 antibody

70R-14302 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FXYD5 antibody

FXYD5 antibody

70R-1682 100 ug
EUR 377
Description: Rabbit polyclonal FXYD5 antibody raised against the N terminal of FXYD5

FXYD5 antibody

70R-1683 100 ug
EUR 377
Description: Rabbit polyclonal FXYD5 antibody raised against the middle region of FXYD5

FXYD5 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FXYD5. Recognizes FXYD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FXYD5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FXYD5. Recognizes FXYD5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Fxyd5/ Rat Fxyd5 ELISA Kit

ELI-48338r 96 Tests
EUR 886

Anti-FXYD5 antibody

STJ192528 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FXYD5


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FXYD5 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Dysadherin/FXYD5 Antibody

PA1765 100ug/vial
EUR 334

FXYD5 Blocking Peptide

33R-5326 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-1682

FXYD5 Blocking Peptide

33R-1922 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-1683

FXYD5 Blocking Peptide

33R-8401 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FXYD5 antibody, catalog no. 70R-6056

FXYD5 cloning plasmid

CSB-CL842655HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 537
  • Sequence: atgtcgccctctggtcgcctgtgtcttcttaccatcgttggcctgattctccccaccagaggacagacgttgaaagataccacgtccagttcttcagcagactcaactatcatggacattcaggtcccgacacgagccccagatgcagtctacacagaactccagcccacctctcc
  • Show more
Description: A cloning plasmid for the FXYD5 gene.

Rat FXYD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-37592h 96 Tests
EUR 824

Mouse Fxyd5 ELISA KIT

ELI-32547m 96 Tests
EUR 865

Human FXYD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FXYD5 protein (His tag)

80R-2672 100 ug
EUR 349
Description: Purified recombinant FXYD5 protein (His tag)

Mouse FXYD5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FXYD5 Recombinant Protein (Human)

RP012706 100 ug Ask for price

FXYD5 Human Recombinant Protein

PROTQ96DB9 Regular: 20ug
EUR 317
Description: FXYD5 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 147 amino acids (22-145 a.a) and having a molecular mass of 16.1kDa. FXYD5 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

FXYD5 Recombinant Protein (Rat)

RP201938 100 ug Ask for price

FXYD5 Recombinant Protein (Mouse)

RP135503 100 ug Ask for price

FXYD5 Recombinant Protein (Mouse)

RP135506 100 ug Ask for price

Human Dysadherin (FXYD5) ELISA Kit

abx259551-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FXYD5 ORF Vector (Human) (pORF)

ORF004236 1.0 ug DNA
EUR 95

Fxyd5 ORF Vector (Rat) (pORF)

ORF067314 1.0 ug DNA
EUR 506

Fxyd5 ORF Vector (Mouse) (pORF)

ORF045169 1.0 ug DNA
EUR 506

Fxyd5 ORF Vector (Mouse) (pORF)

ORF045170 1.0 ug DNA
EUR 506

FXYD5 ELISA Kit (Human) (OKCA00678)

OKCA00678 96 Wells
EUR 833
Description: Description of target: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.75 pg/mL

FXYD5 ELISA Kit (Mouse) (OKCA01669)

OKCA01669 96 Wells
EUR 846
Description: Description of target: Involved in down-regulation of E-cadherin which results in reduced cell adhesion. Promotes metastasis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

FXYD5 sgRNA CRISPR Lentivector set (Human)

K0824301 3 x 1.0 ug
EUR 339

Fxyd5 sgRNA CRISPR Lentivector set (Mouse)

K3958201 3 x 1.0 ug
EUR 339

Fxyd5 sgRNA CRISPR Lentivector set (Rat)

K6799401 3 x 1.0 ug
EUR 339

FXYD5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0824302 1.0 ug DNA
EUR 154

FXYD5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0824303 1.0 ug DNA
EUR 154

FXYD5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0824304 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3958202 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3958203 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3958204 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6799402 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6799403 1.0 ug DNA
EUR 154

Fxyd5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6799404 1.0 ug DNA
EUR 154

Recombinant Human FXYD5 Protein, His, E.coli-1mg

QP11913-1mg 1mg
EUR 2757

Recombinant Human FXYD5 Protein, His, E.coli-20ug

QP11913-20ug 20ug
EUR 201

Recombinant Human FXYD5 Protein, His, E.coli-5ug

QP11913-5ug 5ug
EUR 155

FXYD5 Protein Vector (Rat) (pPB-C-His)

PV269254 500 ng
EUR 603

FXYD5 Protein Vector (Rat) (pPB-N-His)

PV269255 500 ng
EUR 603

FXYD5 Protein Vector (Rat) (pPM-C-HA)

PV269256 500 ng
EUR 603

FXYD5 Protein Vector (Rat) (pPM-C-His)

PV269257 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-C-His)

PV180674 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-N-His)

PV180675 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-HA)

PV180676 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-His)

PV180677 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-C-His)

PV180678 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPB-N-His)

PV180679 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-HA)

PV180680 500 ng
EUR 603

FXYD5 Protein Vector (Mouse) (pPM-C-His)

PV180681 500 ng
EUR 603

FXYD5 Protein Vector (Human) (pPB-C-His)

PV016941 500 ng
EUR 329

FXYD5 Protein Vector (Human) (pPB-N-His)

PV016942 500 ng
EUR 329

FXYD5 Protein Vector (Human) (pPM-C-HA)

PV016943 500 ng
EUR 329

FXYD5 Protein Vector (Human) (pPM-C-His)

PV016944 500 ng
EUR 329

Fxyd5 3'UTR Luciferase Stable Cell Line

TU204848 1.0 ml Ask for price

Fxyd5 3'UTR GFP Stable Cell Line

TU156801 1.0 ml Ask for price

FXYD5 3'UTR Luciferase Stable Cell Line

TU008411 1.0 ml
EUR 1394

Fxyd5 3'UTR Luciferase Stable Cell Line

TU106801 1.0 ml Ask for price

FXYD5 3'UTR GFP Stable Cell Line

TU058411 1.0 ml
EUR 1394

Fxyd5 3'UTR GFP Stable Cell Line

TU254848 1.0 ml Ask for price

Anti-FXYD5 (clone M53)-PEG-cardiac glycoside ADC

ADC-W-079 1mg Ask for price
Description: This ADC product is comprised of an anti-FXYD5 monoclonal antibody (clone M53) conjugated via a PEG linker to cardiac glycoside

FXYD5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV670441 1.0 ug DNA
EUR 514

FXYD5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV670445 1.0 ug DNA
EUR 514

FXYD5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV670446 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

FXYD5 Rabbit Polyclonal Antibody