GFRA2 Rabbit Polyclonal Antibody

GFRA2 Rabbit Polyclonal Antibody

GFRA2 Rabbit pAb
A2954-100ul 100 ul
EUR 308

GFRA2 Rabbit pAb
A2954-200ul 200 ul
EUR 459

GFRA2 Rabbit pAb
A2954-20ul 20 ul
EUR 183

GFRA2 Rabbit pAb
A2954-50ul 50 ul
EUR 223

GFRA2 Antibody
31206-100ul 100ul
EUR 252

GFRA2 Antibody
31206-50ul 50ul
EUR 187

GFRA2 antibody
70R-17467 50 ul
EUR 435
Description: Rabbit polyclonal GFRA2 antibody

GFRA2 Antibody
1-CSB-PA135383
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 Antibody
1-CSB-PA150222
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 antibody
70R-5332 50 ug
EUR 467
Description: Rabbit polyclonal GFRA2 antibody raised against the C terminal of GFRA2

GFRA2 Antibody
1-CSB-PA009380GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GFRA2 Antibody
1-CSB-PA009380LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GFRA2 Conjugated Antibody
C31206 100ul
EUR 397

anti- GFRA2 antibody
FNab03438 100µg
EUR 585
  • Immunogen: GDNF family receptor alpha 2
  • Uniprot ID: O00451
  • Gene ID: 2675
  • Research Area: Neuroscience
Description: Antibody raised against GFRA2

anti- GFRA2 antibody
FNab03439 100µg
EUR 548.75
  • Immunogen: GDNF family receptor alpha 2
  • Uniprot ID: O00451
  • Gene ID: 2675
  • Research Area: Neuroscience
Description: Antibody raised against GFRA2

Anti-GFRA2 antibody
PAab03438 100 ug
EUR 412

Anti-GFRA2 antibody
PAab03439 100 ug
EUR 386

Anti-GFRA2 antibody
STJ23776 100 µl
EUR 277
Description: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-GFRA2 antibody
STJ192348 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GFRA2

Anti-GFRA2 Antibody
STJ60017 100 µg
EUR 424

GFRA2 siRNA
20-abx917800
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GFRA2 siRNA
20-abx917801
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GFRA2 Antibody, HRP conjugated
1-CSB-PA009380LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GFRA2 Antibody, FITC conjugated
1-CSB-PA009380LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GFRA2 Antibody, Biotin conjugated
1-CSB-PA009380LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GFRA2 Blocking Peptide
33R-6924 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFRA2 antibody, catalog no. 70R-5332

GFRA2 cloning plasmid
CSB-CL009380HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1395
  • Sequence: atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgca
  • Show more
Description: A cloning plasmid for the GFRA2 gene.

GFRA2 ELISA KIT|Human
EF009840 96 Tests
EUR 689

Mouse GFRA2 shRNA Plasmid
20-abx970520
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GFRA2 shRNA Plasmid
20-abx951784
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-GFRA2 Plasmid
PVT16798 2 ug
EUR 325

GFRA2 Recombinant Protein (Human)
RP013135 100 ug Ask for price

GFRA2 Recombinant Protein (Rat)
RP202517 100 ug Ask for price

GFRA2 Recombinant Protein (Mouse)
RP136337 100 ug Ask for price

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
20-abx007289
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx028008-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx028008-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx412459-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx233438-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx233439-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
20-abx318070
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human GFRA2 PicoKine ELISA Kit
EK2072 96 wells
EUR 425
Description: For quantitative detection of human GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Mouse GFRA2 PicoKine ELISA Kit
EK2073 96 wells
EUR 425
Description: For quantitative detection of mouse GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rat GFRA2 PicoKine ELISA Kit
EK2074 96 wells
EUR 425
Description: For quantitative detection of rat GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Gfra2 ORF Vector (Rat) (pORF)
ORF067507 1.0 ug DNA
EUR 506

GFRA2 ORF Vector (Human) (pORF)
ORF004379 1.0 ug DNA
EUR 95

Gfra2 ORF Vector (Mouse) (pORF)
ORF045447 1.0 ug DNA
EUR 506

GFRA2 ELISA Kit (Human) (OKBB01439)
OKBB01439 96 Wells
EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 8p21.3. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Gfra2 ELISA Kit (Mouse) (OKBB01440)
OKBB01440 96 Wells
EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 14; 14 D2. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

Gfra2 ELISA Kit (Rat) (OKBB01441)
OKBB01441 96 Wells
EUR 505
Description: Description of target: GDNF family receptor alpha-2 (GFRα2), also known as the neurturin receptor, is a protein that in humans is encoded by the GFRA2 gene. It is mapped to 15p11. The GFRA2 protein is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor. It is part of the GDNF receptor family. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. They both bind the GFRA2 receptor. The receptor mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. GFRA2 (gene) has been shown to interact with GDNF.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (HRP)
20-abx315263
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (FITC)
20-abx315264
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (Biotin)
20-abx315265
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human CellExp? GFRA2 /GDNFRB, human recombinant
7470-100
EUR 718

Human CellExp? GFRA2 /GDNFRB, human recombinant
7470-20
EUR 267

Gfra2 sgRNA CRISPR Lentivector set (Rat)
K6852601 3 x 1.0 ug
EUR 339

GFRA2 Rabbit Polyclonal Antibody