GFRA2 Rabbit Polyclonal Antibody

GFRA2 Rabbit pAb
A2954-100ul	Abclonal	100 ul	EUR 308

GFRA2 Rabbit pAb
A2954-200ul	Abclonal	200 ul	EUR 459

GFRA2 Rabbit pAb
A2954-20ul	Abclonal	20 ul	EUR 183

GFRA2 Rabbit pAb
A2954-50ul	Abclonal	50 ul	EUR 223

GFRA2 Antibody
31206-100ul	SAB	100ul	EUR 252

GFRA2 Antibody
31206-50ul	SAB	50ul	EUR 187

GFRA2 antibody
70R-17467	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GFRA2 antibody

GFRA2 Antibody
1-CSB-PA135383	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 Antibody
1-CSB-PA150222	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

GFRA2 antibody
70R-5332	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GFRA2 antibody raised against the C terminal of GFRA2

GFRA2 Antibody
1-CSB-PA009380GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: 0.1M NaHCO3, 0.1M Glycine, 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GFRA2 Antibody
1-CSB-PA009380LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

GFRA2 Conjugated Antibody
C31206	SAB	100ul	EUR 397

anti- GFRA2 antibody
FNab03438	FN Test	100µg	EUR 585
Immunogen: GDNF family receptor alpha 2 Uniprot ID: O00451 Gene ID: 2675 Research Area: Neuroscience
Description: Antibody raised against GFRA2

anti- GFRA2 antibody
FNab03439	FN Test	100µg	EUR 548.75
Immunogen: GDNF family receptor alpha 2 Uniprot ID: O00451 Gene ID: 2675 Research Area: Neuroscience
Description: Antibody raised against GFRA2

Anti-GFRA2 antibody
PAab03438	Lifescience Market	100 ug	EUR 412

Anti-GFRA2 antibody
PAab03439	Lifescience Market	100 ug	EUR 386

Anti-GFRA2 antibody
STJ23776	St John's Laboratory	100 µl	EUR 277
Description: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This encoded protein acts preferentially as a receptor for NTN compared to its other family member, GDNF family receptor alpha 1. This gene is a candidate gene for RET-associated diseases. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-GFRA2 antibody
STJ192348	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GFRA2

Anti-GFRA2 Antibody
STJ60017	St John's Laboratory	100 µg	EUR 424

GFRA2 siRNA
20-abx917800	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFRA2 siRNA
20-abx917801	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GFRA2 Antibody, HRP conjugated
1-CSB-PA009380LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GFRA2 Antibody, FITC conjugated
1-CSB-PA009380LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GFRA2 Antibody, Biotin conjugated
1-CSB-PA009380LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GFRA2. Recognizes GFRA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GFRA2 Blocking Peptide
33R-6924	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GFRA2 antibody, catalog no. 70R-5332

GFRA2 cloning plasmid
CSB-CL009380HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1395 Sequence: atgatcttggcaaacgtcttctgcctcttcttctttctagacgagaccctccgctctttggccagcccttcctccctgcagggccccgagctccacggctggcgccccccagtggactgtgtccgggccaatgagctgtgtgccgccgaatccaactgcagctctcgctaccgca Show more
Description: A cloning plasmid for the GFRA2 gene.

GFRA2 ELISA KIT|Human
EF009840	Lifescience Market	96 Tests	EUR 689

Mouse GFRA2 shRNA Plasmid
20-abx970520	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GFRA2 shRNA Plasmid
20-abx951784	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-GFRA2 Plasmid
PVT16798	Lifescience Market	2 ug	EUR 325

GFRA2 Recombinant Protein (Human)
RP013135	ABM	100 ug	Ask for price

GFRA2 Recombinant Protein (Rat)
RP202517	ABM	100 ug	Ask for price

GFRA2 Recombinant Protein (Mouse)
RP136337	ABM	100 ug	Ask for price

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
20-abx007289	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx028008-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx028008-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx412459-01mg	Abbexa	0.1 mg	EUR 509
Shipped within 1 week.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx233438-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
abx233439-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody
20-abx318070	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human GFRA2 PicoKine ELISA Kit
EK2072	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Mouse GFRA2 PicoKine ELISA Kit
EK2073	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rat GFRA2 PicoKine ELISA Kit
EK2074	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat GFRA2 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Gfra2 ORF Vector (Rat) (pORF)
ORF067507	ABM	1.0 ug DNA	EUR 506

GFRA2 ORF Vector (Human) (pORF)
ORF004379	ABM	1.0 ug DNA	EUR 95

Gfra2 ORF Vector (Mouse) (pORF)
ORF045447	ABM	1.0 ug DNA	EUR 506

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (HRP)
20-abx315263	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (FITC)
20-abx315264	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GDNF Family Receptor Alpha 2 (GFRA2) Antibody (Biotin)
20-abx315265	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human CellExp? GFRA2 /GDNFRB, human recombinant
7470-100	Biovision		EUR 718

Human CellExp? GFRA2 /GDNFRB, human recombinant
7470-20	Biovision		EUR 267

Gfra2 sgRNA CRISPR Lentivector set (Rat)
K6852601	ABM	3 x 1.0 ug	EUR 339

Gfra2 sgRNA CRISPR Lentivector set (Mouse)
K3373701	ABM	3 x 1.0 ug	EUR 339

GFRA2 sgRNA CRISPR Lentivector set (Human)
K0853101	ABM	3 x 1.0 ug	EUR 339

Recombinant Human GFRA2/GFRα2/GDNFRB Protein
RP00199	Abclonal	5 μg	EUR 136

GFRA2 Rabbit Polyclonal Antibody