GNLY Rabbit Polyclonal Antibody
 ELISA Kit) Human Granulysin (GNLY) ELISA Kit |
|
RD-GNLY-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Granulysin (GNLY) ELISA Kit |
|
RD-GNLY-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Granulysin (GNLY) ELISA Kit |
|
RDR-GNLY-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Granulysin (GNLY) ELISA Kit |
|
RDR-GNLY-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
 GNLY Polyclonal Antibody |
|
ES11035-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNLY Polyclonal Antibody |
|
ES11035-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against GNLY from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNLY Polyclonal Antibody |
|
ABP58659-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
|
ABP58659-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
GNLY Polyclonal Antibody |
|
ABP58659-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GNLY protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of GNLY from Human. This GNLY antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNLY protein |
 GNLY Antibody |
|
43674-100ul |
SAB |
100ul |
EUR 252 |
 ELISA Kit) Rabbit Granulysin (GNLY) ELISA Kit |
|
abx355341-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 GNLY Conjugated Antibody |
|
C43674 |
SAB |
100ul |
EUR 397 |
 Antibody) Granulysin (GNLY) Antibody |
|
abx027191-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Granulysin (GNLY) Antibody |
|
abx027191-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Granulysin (GNLY) Antibody |
|
20-abx172666 |
Abbexa |
|
|
|
|
Granulysin (GNLY) Antibody |
|
20-abx176697 |
Abbexa |
|
|
|
|
 Anti-GNLY antibody |
|
STJ192193 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to GNLY |
 GNLY siRNA |
|
20-abx918218 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-GNLY |
|
YF-PA17076 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to GNLY |
 GNLY cloning plasmid |
|
CSB-CL009627HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 438
- Sequence: atggctacctgggccctcctgctccttgcagccatgctcctgggcaacccaggtctggtcttctctcgtctgagccctgagtactacgacctggcaagagcccacctgcgtgatgaggagaaatcctgcccgtgcctggcccaggagggcccccagggtgacctgttgaccaaaac
- Show more
|
|
Description: A cloning plasmid for the GNLY gene. |
 Protein) Granulysin (GNLY) Protein |
|
20-abx262124 |
Abbexa |
-
EUR 328.00
-
EUR 5089.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
) Anti-GNLY (2A6) |
|
YF-MA17387 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to GNLY |
 Protein) Human Granulysin (GNLY) Protein |
|
20-abx653629 |
Abbexa |
-
EUR 523.00
-
EUR 244.00
-
EUR 1497.00
-
EUR 606.00
-
EUR 384.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 Human GNLY shRNA Plasmid |
|
20-abx957198 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) GNLY Recombinant Protein (Human) |
|
RP013579 |
ABM |
100 ug |
Ask for price |
Human Granulysin (GNLY) ELISA Kit |
|
abx571955-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 Human GNLY/ Granulysin ELISA Kit |
|
E1028Hu |
Sunlong |
1 Kit |
EUR 571 |
 ELISA Kit) Human GNLY(Granulysin) ELISA Kit |
|
EH0156 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.234-15 ng/ml
- Uniprot ID: P22749
- Alias: GNLY(Granulysin)
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.141 ng/ml |
Human Granulysin (GNLY) ELISA Kit |
|
20-abx151728 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
 ELISA Kit) Chicken Granulysin (GNLY) ELISA Kit |
|
abx354664-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Granulysin (GNLY) ELISA Kit |
|
abx354943-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Granulysin (GNLY) ELISA Kit |
|
abx355092-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 CLIA Kit) Human Granulysin (GNLY) CLIA Kit |
|
20-abx492830 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
Human Granulysin (GNLY) ELISA Kit |
|
abx250848-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Granulysin (GNLY) CLIA Kit |
|
abx197066-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Human granulysin,GNLY ELISA Kit |
|
201-12-0355 |
SunredBio |
96 tests |
EUR 440 |
- This granulysin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 Human granulysin, GNLY ELISA Kit |
|
CSB-E09936h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human granulysin, GNLY ELISA Kit |
|
1-CSB-E09936h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human granulysin, GNLY in samples from serum, plasma, cell culture supernates, tissue homogenates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 (pORF)) GNLY ORF Vector (Human) (pORF) |
|
ORF004527 |
ABM |
1.0 ug DNA |
EUR 95 |
 GNLY Granulysin Human Recombinant Protein |
|
PROTP22749 |
BosterBio |
Regular: 10ug |
EUR 317 |
|
Description: GNLY Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 159 amino acids and fused to a double His Tag (N+C terminus) and having a total molecular mass of 18.1 kDa.;The GNLY is purified by proprietary chromatographic techniques. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
SEB517Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Granulysin (GNLY) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Granulysin (GNLY) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Human Granulysin (GNLY) ELISA Kit |
|
4-SEB517Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Granulysin elisa. Alternative names of the recognized antigen: NKG5
- LAG-2
- TLA519
- T-Lymphocyte Activation Gene 519
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Granulysin (GNLY) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
) Human Granulysin ELISA Kit (GNLY) |
|
RK01482 |
Abclonal |
96 Tests |
EUR 521 |
) ELISA kit for Human GNLY (Granulysin) |
|
ELK2059 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Granulysin (GNLY). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Granulysin (GNLY
- Show more
|
|
Description: A sandwich ELISA kit for detection of Granulysin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) GNLY sgRNA CRISPR Lentivector set (Human) |
|
K0878801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) CLIA kit for Human GNLY (Granulysin) |
|
E-CL-H1038 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's GNLY CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human GNLY (Granulysin) |
|
E-EL-H1618 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's GNLY ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GNLY. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human GNLY (Granulysin) in samples from Serum, Plasma, Cell supernatant |
 (Target 1)) GNLY sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0878802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) GNLY sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0878803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) GNLY sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0878804 |
ABM |
1.0 ug DNA |
EUR 154 |
 Recombinant Human GNLY Protein, His, E.coli-10ug |
|
QP12021-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human GNLY Protein, His, E.coli-1mg |
|
QP12021-1mg |
EnQuireBio |
1mg |
EUR 4153 |
 Recombinant Human GNLY Protein, His, E.coli-2ug |
|
QP12021-2ug |
EnQuireBio |
2ug |
EUR 155 |
 (pPB-C-His)) GNLY Protein Vector (Human) (pPB-C-His) |
|
PV018105 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) GNLY Protein Vector (Human) (pPB-N-His) |
|
PV018106 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) GNLY Protein Vector (Human) (pPM-C-HA) |
|
PV018107 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) GNLY Protein Vector (Human) (pPM-C-His) |
|
PV018108 |
ABM |
500 ng |
EUR 329 |
 GNLY 3'UTR Luciferase Stable Cell Line |
|
TU009013 |
ABM |
1.0 ml |
EUR 1394 |
 GNLY 3'UTR GFP Stable Cell Line |
|
TU059013 |
ABM |
1.0 ml |
EUR 1394 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
GNLY Rabbit Polyclonal Antibody
ELISA Kit)
