GNS Rabbit Polyclonal Antibody

GNS Polyclonal Antibody
ABP58661-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270 Applications tips:
Description: A polyclonal antibody for detection of GNS from Human, Mouse. This GNS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270

GNS Polyclonal Antibody
ES11185-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNS Polyclonal Antibody
ES11185-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNS Rabbit pAb
A3891-100ul	Abclonal	100 ul	EUR 308

GNS Rabbit pAb
A3891-200ul	Abclonal	200 ul	EUR 459

GNS Rabbit pAb
A3891-20ul	Abclonal	20 ul	Ask for price

GNS Rabbit pAb
A3891-50ul	Abclonal	50 ul	Ask for price

GNS Rabbit pAb
A7489-100ul	Abclonal	100 ul	EUR 308

GNS Rabbit pAb
A7489-200ul	Abclonal	200 ul	EUR 459

GNS Rabbit pAb
A7489-20ul	Abclonal	20 ul	EUR 183

GNS Rabbit pAb
A7489-50ul	Abclonal	50 ul	EUR 223

GNS Polyclonal Conjugated Antibody
C30947	SAB	100ul	EUR 397

GNS antibody
70R-17542	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GNS antibody

GNS antibody
70R-7202	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GNS antibody raised against the C terminal of GNS

Gns antibody
70R-8622	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Gns antibody

GNS Antibody
1-CSB-PA009639ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNS Antibody
1-CSB-PA009639ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GNS Antibody
1-CSB-PA009639GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal GNS Antibody (Center S298)
AMM04845G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNS (Center S298). This antibody is tested and proven to work in the following applications:

Anti-GNS Antibody
A00999-1	BosterBio	100ug/vial	EUR 294

anti- GNS antibody
FNab03557	FN Test	100µg	EUR 548.75
Immunogen: glucosamine(N-acetyl)-6-sulfatase Uniprot ID: P15586 Gene ID: 2799 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GNS

Anti-GNS antibody
PAab03557	Lifescience Market	100 ug	EUR 386

Anti-GNS antibody
STJ29625	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome.

Anti-GNS antibody
STJ23828	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome.

Anti-GNS antibody
STJ192343	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GNS

GNS siRNA
20-abx918239	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GNS siRNA
20-abx918240	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GNS
YF-PA12077	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GNS

anti-GNS
YF-PA12078	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to GNS

Gns Blocking Peptide
33R-10135	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Gns antibody, catalog no. 70R-8622

GNS Blocking Peptide
33R-7159	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNS antibody, catalog no. 70R-7202

GNS cloning plasmid
CSB-CL009639HU-10ug	Cusabio	10ug	EUR 574
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1659 Sequence: atgcggctcctgcctctagccccaggtcggctccggcggggcagcccccgccacctgccctcctgcagcccagcgctgctactgctggtgctgggcggctgcctgggggtcttcggggtggctgcgggaacccggaggcccaacgtggtgctgctcctcacggacgaccaggacg Show more
Description: A cloning plasmid for the GNS gene.

GNS ELISA KIT|Human
EF009927	Lifescience Market	96 Tests	EUR 689

Mouse GNS shRNA Plasmid
20-abx978444	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GNS shRNA Plasmid
20-abx951869	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GNS Recombinant Protein (Human)
RP013609	ABM	100 ug	Ask for price

GNS Recombinant Protein (Rat)
RP203081	ABM	100 ug	Ask for price

GNS Recombinant Protein (Mouse)
RP139097	ABM	100 ug	Ask for price

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx006987	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx002834	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx116840	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx036402-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx032877-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx032877-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx321043	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx233557-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx322511	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx225195	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Gns ORF Vector (Rat) (pORF)
ORF067695	ABM	1.0 ug DNA	EUR 506

GNS ORF Vector (Human) (pORF)
ORF004537	ABM	1.0 ug DNA	EUR 95

Gns ORF Vector (Mouse) (pORF)
ORF046367	ABM	1.0 ug DNA	EUR 506

GNS Rabbit Polyclonal Antibody