GNS Rabbit Polyclonal Antibody

GNS Rabbit Polyclonal Antibody

GNS Polyclonal Antibody
ABP58661-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of GNS from Human, Mouse. This GNS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNS protein at amino acid sequence of 190-270

GNS Polyclonal Antibody
ES11185-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNS Polyclonal Antibody
ES11185-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNS from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

GNS Rabbit pAb
A3891-100ul 100 ul
EUR 308

GNS Rabbit pAb
A3891-200ul 200 ul
EUR 459

GNS Rabbit pAb
A3891-20ul 20 ul Ask for price

GNS Rabbit pAb
A3891-50ul 50 ul Ask for price

GNS Rabbit pAb
A7489-100ul 100 ul
EUR 308

GNS Rabbit pAb
A7489-200ul 200 ul
EUR 459

GNS Rabbit pAb
A7489-20ul 20 ul
EUR 183

GNS Rabbit pAb
A7489-50ul 50 ul
EUR 223

GNS Polyclonal Conjugated Antibody
C30947 100ul
EUR 397

GNS antibody
70R-17542 50 ul
EUR 435
Description: Rabbit polyclonal GNS antibody

GNS antibody
70R-7202 50 ug
EUR 467
Description: Rabbit polyclonal GNS antibody raised against the C terminal of GNS

Gns antibody
70R-8622 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Gns antibody

GNS Antibody
1-CSB-PA009639ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNS Antibody
1-CSB-PA009639ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

GNS Antibody
1-CSB-PA009639GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNS. Recognizes GNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal GNS Antibody (Center S298)
AMM04845G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNS (Center S298). This antibody is tested and proven to work in the following applications:

Anti-GNS Antibody
A00999-1 100ug/vial
EUR 294

anti- GNS antibody
FNab03557 100µg
EUR 548.75
  • Immunogen: glucosamine(N-acetyl)-6-sulfatase
  • Uniprot ID: P15586
  • Gene ID: 2799
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GNS

Anti-GNS antibody
PAab03557 100 ug
EUR 386

Anti-GNS antibody
STJ29625 100 µl
EUR 277
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome.

Anti-GNS antibody
STJ23828 100 µl
EUR 277
Description: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome.

Anti-GNS antibody
STJ192343 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNS

GNS siRNA
20-abx918239
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNS siRNA
20-abx918240
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GNS
YF-PA12077 50 ug
EUR 363
Description: Mouse polyclonal to GNS

anti-GNS
YF-PA12078 100 ug
EUR 403
Description: Rabbit polyclonal to GNS

Gns Blocking Peptide
33R-10135 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Gns antibody, catalog no. 70R-8622

GNS Blocking Peptide
33R-7159 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNS antibody, catalog no. 70R-7202

GNS cloning plasmid
CSB-CL009639HU-10ug 10ug
EUR 574
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1659
  • Sequence: atgcggctcctgcctctagccccaggtcggctccggcggggcagcccccgccacctgccctcctgcagcccagcgctgctactgctggtgctgggcggctgcctgggggtcttcggggtggctgcgggaacccggaggcccaacgtggtgctgctcctcacggacgaccaggacg
  • Show more
Description: A cloning plasmid for the GNS gene.

GNS ELISA KIT|Human
EF009927 96 Tests
EUR 689

Mouse GNS shRNA Plasmid
20-abx978444
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GNS shRNA Plasmid
20-abx951869
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNS Recombinant Protein (Human)
RP013609 100 ug Ask for price

GNS Recombinant Protein (Rat)
RP203081 100 ug Ask for price

GNS Recombinant Protein (Mouse)
RP139097 100 ug Ask for price

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx006987
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx002834
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx116840
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx036402-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx032877-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx032877-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx321043
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
abx233557-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx322511
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acetylglucosamine-6-Sulfatase (GNS) Antibody
20-abx225195
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gns ORF Vector (Rat) (pORF)
ORF067695 1.0 ug DNA
EUR 506

GNS ORF Vector (Human) (pORF)
ORF004537 1.0 ug DNA
EUR 95

Gns ORF Vector (Mouse) (pORF)
ORF046367 1.0 ug DNA
EUR 506

GNS Rabbit Polyclonal Antibody