GPC2 Rabbit Polyclonal Antibody

GPC2 Polyclonal Antibody
ES10943-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPC2 Polyclonal Antibody
ES10943-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPC2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Glypican 2 (GPC2) ELISA Kit
DLR-GPC2-Hu-48T	DL Develop	48T	EUR 498
Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glypican 2 (GPC2) ELISA Kit
DLR-GPC2-Hu-96T	DL Develop	96T	EUR 647
Should the Human Glypican 2 (GPC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glypican 2 (GPC2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glypican 2 (GPC2) ELISA Kit
RDR-GPC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Glypican 2 (GPC2) ELISA Kit
RDR-GPC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Glypican 2 (GPC2) ELISA Kit
RD-GPC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Glypican 2 (GPC2) ELISA Kit
RD-GPC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

GPC2 Antibody
47512-100ul	SAB	100ul	EUR 252

Rabbit GPC2 ELISA Kit
ERTG0234	Abclonal	96Tests	EUR 521

Polyclonal GPC2 Antibody (N-term)
APR16461G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal GPC2 Antibody - C-terminal region
APR16462G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPC2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Gpc2/ Rat Gpc2 ELISA Kit
ELI-04913r	Lifescience Market	96 Tests	EUR 886

GPC2 Conjugated Antibody
C47512	SAB	100ul	EUR 397

Anti-GPC2 Antibody
STJ193197	St John's Laboratory	200 µl	EUR 197

Anti-GPC2 antibody
STJ192101	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPC2

GPC2 siRNA
20-abx902253	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPC2 siRNA
20-abx918352	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPC2 siRNA
20-abx918353	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rabbit Glypican 2 (GPC2) ELISA Kit
abx363696-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Glypican 2 (GPC2) Antibody
20-abx176682	Abbexa	EUR 1149.00 EUR 565.00	1 mg 200 ug
Please enquire.

Glypican 2 (GPC2) Antibody
20-abx172654	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Glypican 2 (GPC2) Antibody
abx028841-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glypican 2 (GPC2) Antibody
abx028841-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

GPC2 cloning plasmid
CSB-CL818680HU-10ug	Cusabio	10ug	EUR 597
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1740 Sequence: atgtccgcgctgcgacctctcctgcttctgctgctgcctctgtgtcccggtcctggtcccggacccgggagcgaggcaaaggtcacccggagttgtgcagagacccggcaggtgctgggggcccggggatatagcttaaacctaatccctcccgccctgatctcaggtgagcacc Show more
Description: A cloning plasmid for the GPC2 gene.

Human GPC2 ELISA Kit
EHG0234	Abclonal	96Tests	EUR 521

Human GPC2 ELISA Kit
ELA-E1493h	Lifescience Market	96 Tests	EUR 824

Goat GPC2 ELISA Kit
EGTG0234	Abclonal	96Tests	EUR 521

Bovine GPC2 ELISA Kit
EBG0234	Abclonal	96Tests	EUR 521

Canine GPC2 ELISA Kit
ECG0234	Abclonal	96Tests	EUR 521

Chicken GPC2 ELISA Kit
ECKG0234	Abclonal	96Tests	EUR 521

Anserini GPC2 ELISA Kit
EAG0234	Abclonal	96Tests	EUR 521

GPC2 ELISA KIT|Human
EF005822	Lifescience Market	96 Tests	EUR 689

Rat GPC2 shRNA Plasmid
20-abx987790	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GPC2 shRNA Plasmid
20-abx977595	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPC2 Rabbit Polyclonal Antibody