HAND2 Rabbit Polyclonal Antibody

HAND2 Rabbit Polyclonal Antibody

HAND2 Polyclonal Antibody
ES11038-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HAND2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HAND2 Polyclonal Antibody
ES11038-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HAND2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HAND2 Rabbit pAb
A7044-100ul 100 ul
EUR 308

HAND2 Rabbit pAb
A7044-200ul 200 ul
EUR 459

HAND2 Rabbit pAb
A7044-20ul 20 ul
EUR 183

HAND2 Rabbit pAb
A7044-50ul 50 ul
EUR 223

HAND2 Polyclonal Conjugated Antibody
C30800 100ul
EUR 397

HAND2 antibody
10R-1600 100 ug
EUR 512
Description: Mouse monoclonal HAND2 antibody

Hand2 antibody
70R-7837 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hand2 antibody

HAND2 Antibody
1-CSB-PA010126ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against HAND2. Recognizes HAND2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal DHAND / HAND2 Antibody (aa194-207)
APR11718G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHAND / HAND2 (aa194-207). This antibody is tested and proven to work in the following applications:

Polyclonal Hand2 antibody - C-terminal region
AMM06000G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hand2 - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-HAND2 antibody
STJ29124 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development.

Anti-HAND2 Antibody
STJ501310 100 µg
EUR 476

Anti-HAND2 antibody
STJ192196 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HAND2

Hand2/ Rat Hand2 ELISA Kit
ELI-27735r 96 Tests
EUR 886

HAND2 siRNA
20-abx902408
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAND2 siRNA
20-abx919065
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HAND2 siRNA
20-abx919066
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-HAND2 Antibody BIOTIN
STJ501311 100 µg
EUR 586

Anti-HAND2 Antibody FITC
STJ501312 100 µg
EUR 586

Anti-Hand2 (zebrafish) antibody
STJ71256 100 µg
EUR 260

Hand2 Blocking Peptide
33R-2133 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hand2 antibody, catalog no. 70R-7837

HAND2 cloning plasmid
CSB-CL010126HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 543
  • Sequence: ATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACCCGTTTGCCGCCGCCGCCGCCGCCAGCCGCTGCAGCCATGAGGAGAACCCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAG
  • Show more
Description: A cloning plasmid for the HAND2 gene.

Anti-HAND2 (4H8)
YF-MA11179 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4D11)
YF-MA16846 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (3E3)
YF-MA16847 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4E12)
YF-MA16848 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4D9)
YF-MA16849 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (3D5)
YF-MA16850 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (1C7)
YF-MA16851 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (4B11)
YF-MA16852 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (2C10)
YF-MA16853 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Anti-HAND2 (3F10)
YF-MA16854 100 ug
EUR 363
Description: Mouse monoclonal to HAND2

Chicken HAND2 ELISA KIT
ELI-08810c 96 Tests
EUR 928

Human HAND2 ELISA KIT
ELI-19231h 96 Tests
EUR 824

Mouse Hand2 ELISA KIT
ELI-19232m 96 Tests
EUR 865

HAND2 ELISA KIT|Human
EF005082 96 Tests
EUR 689

Rat HAND2 shRNA Plasmid
20-abx986324
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HAND2 shRNA Plasmid
20-abx956279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HAND2 shRNA Plasmid
20-abx970746
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pECMV-3-FLAG-HAND2
PVT13397 2 ug
EUR 599

pcDNA3.1-HA-HAND2 Plasmid
PVTB00114-2a 2 ug
EUR 356

HAND2 Recombinant Protein (Human)
RP039712 100 ug Ask for price

HAND2 Recombinant Protein (Rat)
RP204176 100 ug Ask for price

HAND2 Recombinant Protein (Mouse)
RP140897 100 ug Ask for price

Heart and neural crest derivatives expressed 2 (HAND2) polyclonal antibody
ABP-PAB-10481 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Monoclonal HAND2 Antibody (monoclonal) (M06), Clone: 3D5
APG03379G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3D5. This antibody is applicable in WB

Monoclonal HAND2 Antibody (monoclonal) (M05), Clone: 4D9
APR12324G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 4D9. This antibody is applicable in WB and IF

Hand2 ORF Vector (Rat) (pORF)
ORF068060 1.0 ug DNA
EUR 506

HAND2 ORF Vector (Human) (pORF)
ORF013238 1.0 ug DNA
EUR 95

Hand2 ORF Vector (Mouse) (pORF)
ORF046967 1.0 ug DNA
EUR 506

pECMV-Hand2-m-FLAG Plasmid
PVT15424 2 ug
EUR 325

pCR-BluntII-TOPO-HAND2 Plasmid
PVTB00244S 2 ug
EUR 356

HAND2 ELISA Kit (Human) (OKCD01870)
OKCD01870 96 Wells
EUR 831
Description: Description of target: Essential for cardiac morphogenesis, particularly for the formation of the right ventricle and of the aortic arch arteries. Required for vascular development and regulation of angiogenesis, possibly through a VEGF signaling pathway. Plays also an important role in limb development, particularly in the establishment of anterior-posterior polarization, acting as an upstream regulator of sonic hedgehog (SHH) induction in the limb bud. Is involved in the development of branchial arches, which give rise to unique structures in the head and neck. Binds DNA on E-box consensus sequence 5'-CANNTG-3'.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

Hand2 sgRNA CRISPR Lentivector set (Rat)
K7606701 3 x 1.0 ug
EUR 339

Hand2 sgRNA CRISPR Lentivector set (Mouse)
K3919401 3 x 1.0 ug
EUR 339

HAND2 sgRNA CRISPR Lentivector set (Human)
K0928401 3 x 1.0 ug
EUR 339

Hand2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7606702 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7606703 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7606704 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3919402 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3919403 1.0 ug DNA
EUR 154

Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3919404 1.0 ug DNA
EUR 154

HAND2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0928402 1.0 ug DNA
EUR 154

HAND2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0928403 1.0 ug DNA
EUR 154

HAND2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0928404 1.0 ug DNA
EUR 154

HAND2 Protein Vector (Rat) (pPB-C-His)
PV272238 500 ng
EUR 603

HAND2 Protein Vector (Rat) (pPB-N-His)
PV272239 500 ng
EUR 603

HAND2 Protein Vector (Rat) (pPM-C-HA)
PV272240 500 ng
EUR 603

HAND2 Protein Vector (Rat) (pPM-C-His)
PV272241 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPB-C-His)
PV187866 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPB-N-His)
PV187867 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPM-C-HA)
PV187868 500 ng
EUR 603

HAND2 Protein Vector (Mouse) (pPM-C-His)
PV187869 500 ng
EUR 603

HAND2 Protein Vector (Human) (pPB-C-His)
PV052949 500 ng
EUR 481

HAND2 Protein Vector (Human) (pPB-N-His)
PV052950 500 ng
EUR 481

HAND2 Protein Vector (Human) (pPM-C-HA)
PV052951 500 ng
EUR 481

HAND2 Protein Vector (Human) (pPM-C-His)
PV052952 500 ng
EUR 481

Recombinant Human HAND2 Protein, GST, E.coli-100ug
QP6142-ec-100ug 100ug
EUR 571

Recombinant Human HAND2 Protein, GST, E.coli-10ug
QP6142-ec-10ug 10ug
EUR 272

Recombinant Human HAND2 Protein, GST, E.coli-1mg
QP6142-ec-1mg 1mg
EUR 2303

Recombinant Human HAND2 Protein, GST, E.coli-200ug
QP6142-ec-200ug 200ug
EUR 898

Recombinant Human HAND2 Protein, GST, E.coli-500ug
QP6142-ec-500ug 500ug
EUR 1514

Recombinant Human HAND2 Protein, GST, E.coli-50ug
QP6142-ec-50ug 50ug
EUR 362

Hand2 3'UTR Luciferase Stable Cell Line
TU109349 1.0 ml Ask for price

Hand2 3'UTR Luciferase Stable Cell Line
TU205628 1.0 ml Ask for price

Hand2 3'UTR GFP Stable Cell Line
TU159349 1.0 ml Ask for price

Hand2 3'UTR GFP Stable Cell Line
TU255628 1.0 ml Ask for price

HAND2 3'UTR GFP Stable Cell Line
TU059547 1.0 ml
EUR 1394

HAND2 3'UTR Luciferase Stable Cell Line
TU009547 1.0 ml
EUR 1394

HAND2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV672607 1.0 ug DNA
EUR 514

HAND2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV672611 1.0 ug DNA
EUR 514

HAND2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV672612 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

HAND2 Rabbit Polyclonal Antibody