HAND2 Rabbit Polyclonal Antibody
HAND2 Polyclonal Antibody |
ES11038-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HAND2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HAND2 Polyclonal Antibody |
ES11038-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HAND2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HAND2 Rabbit pAb |
A7044-100ul |
Abclonal |
100 ul |
EUR 308 |
HAND2 Rabbit pAb |
A7044-200ul |
Abclonal |
200 ul |
EUR 459 |
HAND2 Rabbit pAb |
A7044-20ul |
Abclonal |
20 ul |
EUR 183 |
HAND2 Rabbit pAb |
A7044-50ul |
Abclonal |
50 ul |
EUR 223 |
HAND2 Polyclonal Conjugated Antibody |
C30800 |
SAB |
100ul |
EUR 397 |
HAND2 antibody |
10R-1600 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal HAND2 antibody |
Hand2 antibody |
70R-7837 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Hand2 antibody |
HAND2 Antibody |
1-CSB-PA010126ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against HAND2. Recognizes HAND2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal DHAND / HAND2 Antibody (aa194-207) |
APR11718G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHAND / HAND2 (aa194-207). This antibody is tested and proven to work in the following applications: |
Polyclonal Hand2 antibody - C-terminal region |
AMM06000G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hand2 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-HAND2 antibody |
STJ29124 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. |
Anti-HAND2 antibody |
STJ192196 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HAND2 |
HAND2 siRNA |
20-abx902408 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND2 siRNA |
20-abx919065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HAND2 siRNA |
20-abx919066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Hand2 Blocking Peptide |
33R-2133 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hand2 antibody, catalog no. 70R-7837 |
HAND2 cloning plasmid |
CSB-CL010126HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 543
- Sequence: ATGAGTCTGGTAGGTGGTTTTCCCCACCACCCGGTGGTGCACCACGAGGGCTACCCGTTTGCCGCCGCCGCCGCCGCCAGCCGCTGCAGCCATGAGGAGAACCCCTACTTCCATGGCTGGCTCATCGGCCACCCCGAGATGTCGCCCCCCGACTACAGCATGGCCCTGTCCTACAG
- Show more
|
Description: A cloning plasmid for the HAND2 gene. |
Anti-HAND2 (4H8) |
YF-MA11179 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4D11) |
YF-MA16846 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (3E3) |
YF-MA16847 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4E12) |
YF-MA16848 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4D9) |
YF-MA16849 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (3D5) |
YF-MA16850 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (1C7) |
YF-MA16851 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (4B11) |
YF-MA16852 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (2C10) |
YF-MA16853 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Anti-HAND2 (3F10) |
YF-MA16854 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HAND2 |
Rat HAND2 shRNA Plasmid |
20-abx986324 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HAND2 shRNA Plasmid |
20-abx956279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse HAND2 shRNA Plasmid |
20-abx970746 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HAND2 Recombinant Protein (Human) |
RP039712 |
ABM |
100 ug |
Ask for price |
HAND2 Recombinant Protein (Rat) |
RP204176 |
ABM |
100 ug |
Ask for price |
HAND2 Recombinant Protein (Mouse) |
RP140897 |
ABM |
100 ug |
Ask for price |
Heart and neural crest derivatives expressed 2 (HAND2) polyclonal antibody |
ABP-PAB-10481 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Genetic Disease Markers
- Brand:
|
Monoclonal HAND2 Antibody (monoclonal) (M06), Clone: 3D5 |
APG03379G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 3D5. This antibody is applicable in WB |
Monoclonal HAND2 Antibody (monoclonal) (M05), Clone: 4D9 |
APR12324G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human HAND2 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 4D9. This antibody is applicable in WB and IF |
Hand2 ORF Vector (Rat) (pORF) |
ORF068060 |
ABM |
1.0 ug DNA |
EUR 506 |
HAND2 ORF Vector (Human) (pORF) |
ORF013238 |
ABM |
1.0 ug DNA |
EUR 95 |
Hand2 ORF Vector (Mouse) (pORF) |
ORF046967 |
ABM |
1.0 ug DNA |
EUR 506 |
HAND2 ELISA Kit (Human) (OKCD01870) |
OKCD01870 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Essential for cardiac morphogenesis, particularly for the formation of the right ventricle and of the aortic arch arteries. Required for vascular development and regulation of angiogenesis, possibly through a VEGF signaling pathway. Plays also an important role in limb development, particularly in the establishment of anterior-posterior polarization, acting as an upstream regulator of sonic hedgehog (SHH) induction in the limb bud. Is involved in the development of branchial arches, which give rise to unique structures in the head and neck. Binds DNA on E-box consensus sequence 5'-CANNTG-3'.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL |
Hand2 sgRNA CRISPR Lentivector set (Rat) |
K7606701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hand2 sgRNA CRISPR Lentivector set (Mouse) |
K3919401 |
ABM |
3 x 1.0 ug |
EUR 339 |
HAND2 sgRNA CRISPR Lentivector set (Human) |
K0928401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hand2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7606702 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7606703 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7606704 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3919402 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3919403 |
ABM |
1.0 ug DNA |
EUR 154 |
Hand2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3919404 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0928402 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0928403 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0928404 |
ABM |
1.0 ug DNA |
EUR 154 |
HAND2 Protein Vector (Rat) (pPB-C-His) |
PV272238 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Rat) (pPB-N-His) |
PV272239 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Rat) (pPM-C-HA) |
PV272240 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Rat) (pPM-C-His) |
PV272241 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPB-C-His) |
PV187866 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPB-N-His) |
PV187867 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPM-C-HA) |
PV187868 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Mouse) (pPM-C-His) |
PV187869 |
ABM |
500 ng |
EUR 603 |
HAND2 Protein Vector (Human) (pPB-C-His) |
PV052949 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Human) (pPB-N-His) |
PV052950 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Human) (pPM-C-HA) |
PV052951 |
ABM |
500 ng |
EUR 481 |
HAND2 Protein Vector (Human) (pPM-C-His) |
PV052952 |
ABM |
500 ng |
EUR 481 |
Recombinant Human HAND2 Protein, GST, E.coli-100ug |
QP6142-ec-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Human HAND2 Protein, GST, E.coli-10ug |
QP6142-ec-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Human HAND2 Protein, GST, E.coli-1mg |
QP6142-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Human HAND2 Protein, GST, E.coli-200ug |
QP6142-ec-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Human HAND2 Protein, GST, E.coli-500ug |
QP6142-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Human HAND2 Protein, GST, E.coli-50ug |
QP6142-ec-50ug |
EnQuireBio |
50ug |
EUR 362 |
Hand2 3'UTR Luciferase Stable Cell Line |
TU109349 |
ABM |
1.0 ml |
Ask for price |
Hand2 3'UTR Luciferase Stable Cell Line |
TU205628 |
ABM |
1.0 ml |
Ask for price |
Hand2 3'UTR GFP Stable Cell Line |
TU159349 |
ABM |
1.0 ml |
Ask for price |
Hand2 3'UTR GFP Stable Cell Line |
TU255628 |
ABM |
1.0 ml |
Ask for price |
HAND2 3'UTR GFP Stable Cell Line |
TU059547 |
ABM |
1.0 ml |
EUR 1394 |
HAND2 3'UTR Luciferase Stable Cell Line |
TU009547 |
ABM |
1.0 ml |
EUR 1394 |
HAND2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV672607 |
ABM |
1.0 ug DNA |
EUR 514 |
HAND2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV672611 |
ABM |
1.0 ug DNA |
EUR 514 |
HAND2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV672612 |
ABM |
1.0 ug DNA |
EUR 514 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
HAND2 Rabbit Polyclonal Antibody