
셀타젠 Genetic Genotyping

HBB Rabbit Polyclonal Antibody

HBB Rabbit Polyclonal Antibody

Human Hemoglobin Beta (HBb) ELISA Kit

RDR-HBb-Hu-48Tests 48 Tests
EUR 544

Human Hemoglobin Beta (HBb) ELISA Kit

RDR-HBb-Hu-96Tests 96 Tests
EUR 756

HBB Polyclonal Antibody

ES11412-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HBB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HBB Polyclonal Antibody

ES11412-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HBB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HBB Polyclonal Antibody

ABP58753-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HBB protein
  • Applications tips:
Description: A polyclonal antibody for detection of HBB from Human. This HBB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBB protein

HBB Polyclonal Antibody

ABP58753-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HBB protein
  • Applications tips:
Description: A polyclonal antibody for detection of HBB from Human. This HBB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBB protein

HBB Polyclonal Antibody

ABP58753-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HBB protein
  • Applications tips:
Description: A polyclonal antibody for detection of HBB from Human. This HBB antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBB protein

HBB Polyclonal Antibody

A50281 100 µg
EUR 570.55
Description: Ask the seller for details

HBB Rabbit pAb

A1331-100ul 100 ul
EUR 308

HBB Rabbit pAb

A1331-200ul 200 ul
EUR 459

HBB Rabbit pAb

A1331-20ul 20 ul
EUR 183

HBB Rabbit pAb

A1331-50ul 50 ul
EUR 223

Hbb-b2 Polyclonal Antibody

A53598 100 µg
EUR 570.55
Description: Ask the seller for details

Polyclonal HBB Antibody (C-term)

APR03574G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HBB (C-term). This antibody is tested and proven to work in the following applications:

HBB Polyclonal Antibody, HRP Conjugated

A50282 100 µg
EUR 570.55
Description: The best epigenetics products

HBB Polyclonal Antibody, FITC Conjugated

A50283 100 µg
EUR 570.55
Description: kits suitable for this type of research

HBB Polyclonal Antibody, Biotin Conjugated

A50284 100 µg
EUR 570.55
Description: fast delivery possible

HBB Antibody

47773-100ul 100ul
EUR 252

HBB antibody

70R-17690 50 ul
EUR 435
Description: Rabbit polyclonal HBB antibody

HBB Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HBB. Recognizes HBB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

HBB Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBB. Recognizes HBB from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500

Hbb-b2 Polyclonal Antibody, HRP Conjugated

A53599 100 µg
EUR 570.55
Description: The best epigenetics products

Hbb-b2 Polyclonal Antibody, FITC Conjugated

A53600 100 µg
EUR 570.55
Description: kits suitable for this type of research

Hbb-b2 Polyclonal Antibody, Biotin Conjugated

A53601 100 µg
EUR 570.55
Description: fast delivery possible

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine)

  • EUR 276.00
  • EUR 2972.00
  • EUR 730.00
  • EUR 352.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb)

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb)

Hemoglobin Beta (HBb) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb)

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb)

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep)

  • EUR 289.00
  • EUR 3170.00
  • EUR 775.00
  • EUR 370.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb)

HBB Conjugated Antibody

C47773 100ul
EUR 397

anti- HBB antibody

FNab03768 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:4000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: hemoglobin, beta
  • Uniprot ID: P68871
  • Gene ID: 3043
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against HBB

Hbb-b2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hbb-b2. Recognizes Hbb-b2 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

Anti-HBB antibody

PAab03768 100 ug
EUR 386

Anti-HBB antibody

STJ111074 100 µl
EUR 277
Description: The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'.

Anti-HBB antibody

STJ192570 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HBB

Hbb/ Rat Hbb ELISA Kit

ELI-02401r 96 Tests
EUR 886

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), APC

  • EUR 389.00
  • EUR 3905.00
  • EUR 1070.00
  • EUR 503.00
  • EUR 238.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), Biotinylated

  • EUR 344.00
  • EUR 2922.00
  • EUR 843.00
  • EUR 427.00
  • EUR 233.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), Cy3

  • EUR 477.00
  • EUR 5165.00
  • EUR 1385.00
  • EUR 629.00
  • EUR 276.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), FITC

  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), HRP

  • EUR 354.00
  • EUR 3401.00
  • EUR 944.00
  • EUR 452.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), PE

  • EUR 331.00
  • EUR 3144.00
  • EUR 876.00
  • EUR 422.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with PE.

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with PE.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with PE.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with PE.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), APC

  • EUR 408.00
  • EUR 4175.00
  • EUR 1137.00
  • EUR 530.00
  • EUR 246.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), Biotinylated

  • EUR 357.00
  • EUR 3120.00
  • EUR 892.00
  • EUR 447.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), Cy3

  • EUR 503.00
  • EUR 5525.00
  • EUR 1475.00
  • EUR 665.00
  • EUR 287.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), FITC

  • EUR 346.00
  • EUR 3360.00
  • EUR 930.00
  • EUR 444.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), HRP

  • EUR 370.00
  • EUR 3635.00
  • EUR 1002.00
  • EUR 476.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), PE

  • EUR 346.00
  • EUR 3360.00
  • EUR 930.00
  • EUR 444.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with PE.

Rabbit Hemoglobin Beta (HBb) ELISA Kit

abx362395-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27242 50 ug
EUR 363
Description: Mouse polyclonal to HBB

Hemoglobin Beta (HBB) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBB) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1442.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 495.00
  • EUR 133.00
  • EUR 1497.00
  • EUR 704.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hemoglobin Beta (HBB) Antibody

  • EUR 411.00
  • EUR 1038.00
  • EUR 523.00
  • EUR 154.00
  • EUR 286.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBB) Antibody

abx018047-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBB) Antibody

abx018048-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 356.00
  • EUR 913.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody

  • EUR 1497.00
  • EUR 704.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemoglobin Beta (HBB) Antibody

abx233768-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Hemoglobin Beta (HBB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HBB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBB. Recognizes HBB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HBB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBB. Recognizes HBB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HBB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBB. Recognizes HBB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hemoglobin Beta (HBb) Polyclonal Antibody (Bovine), APC-Cy7

  • EUR 659.00
  • EUR 7690.00
  • EUR 2020.00
  • EUR 886.00
  • EUR 356.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Hemoglobin Beta (HBb). This antibody is labeled with APC-Cy7.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine)

  • EUR 280.00
  • EUR 3038.00
  • EUR 745.00
  • EUR 358.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb)

Hemoglobin Beta (HBb) Polyclonal Antibody (Chicken), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Chicken Hemoglobin Beta (HBb). This antibody is labeled with APC-Cy7.

Hemoglobin Beta (HBb) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with APC-Cy7.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hemoglobin Beta (HBb). This antibody is labeled with APC-Cy7.

Hemoglobin Beta (HBb) Polyclonal Antibody (Sheep), APC-Cy7

  • EUR 697.00
  • EUR 8230.00
  • EUR 2155.00
  • EUR 940.00
  • EUR 373.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His145)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with APC-Cy7.

Hemoglobin Beta (HBb) Antibody (FITC)

  • EUR 509.00
  • EUR 258.00
  • EUR 1525.00
  • EUR 704.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hemoglobin Beta (HBb) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBb) Antibody (Biotin)

  • EUR 537.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 759.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemoglobin Beta (HBB) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBB) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBB) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hbb-b2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hbb-b2. Recognizes Hbb-b2 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Hbb-b2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hbb-b2. Recognizes Hbb-b2 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Hbb-b2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hbb-b2. Recognizes Hbb-b2 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), APC

  • EUR 395.00
  • EUR 3995.00
  • EUR 1092.00
  • EUR 512.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), Biotinylated

  • EUR 348.00
  • EUR 2988.00
  • EUR 859.00
  • EUR 433.00
  • EUR 235.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), Cy3

  • EUR 486.00
  • EUR 5285.00
  • EUR 1415.00
  • EUR 641.00
  • EUR 279.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), FITC

  • EUR 336.00
  • EUR 3216.00
  • EUR 894.00
  • EUR 429.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), HRP

  • EUR 359.00
  • EUR 3479.00
  • EUR 963.00
  • EUR 460.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), PE

  • EUR 336.00
  • EUR 3216.00
  • EUR 894.00
  • EUR 429.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with PE.

HBB cloning plasmid

CSB-CL010150HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 444
  • Sequence: atggtgcacctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccacccctgatgctgttatgggcaaccc
  • Show more
Description: A cloning plasmid for the HBB gene.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBb) Polyclonal Antibody (Mouse, Rat, Bovine), APC-Cy7

  • EUR 671.00
  • EUR 7870.00
  • EUR 2065.00
  • EUR 904.00
  • EUR 362.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBb (Met1~His147)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat, Bovine Hemoglobin Beta (HBb). This antibody is labeled with APC-Cy7.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb)

Hemoglobin Beta (HBb) Monoclonal Antibody (Sheep)

  • EUR 297.00
  • EUR 3302.00
  • EUR 805.00
  • EUR 382.00
  • EUR 235.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: full length
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Sheep Hemoglobin Beta (HBb)

Rat HBB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELA-E0692h 96 Tests
EUR 824


ELI-02407d 96 Tests
EUR 928

Human HBB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Native Hemoglobin Beta (HBb)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02075
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Sheep Hemoglobin Beta expressed in: Sheep

Recombinant Hemoglobin Beta (HBb)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02070
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.6kDa
  • Isoelectric Point: 8.6
Description: Recombinant Bovine Hemoglobin Beta expressed in: E.coli

Recombinant Hemoglobin Beta (HBb)

  • EUR 539.04
  • EUR 247.00
  • EUR 1746.40
  • EUR 648.80
  • EUR 1197.60
  • EUR 424.00
  • EUR 4216.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02062
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.0kDa
  • Isoelectric Point: 7
Description: Recombinant Horse Hemoglobin Beta expressed in: E.coli

Recombinant Hemoglobin Beta (HBb)

  • EUR 324.00
  • EUR 190.00
  • EUR 940.00
  • EUR 380.00
  • EUR 660.00
  • EUR 280.00
  • EUR 2200.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02112
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.2kDa
  • Isoelectric Point: 6.7
Description: Recombinant Chicken Hemoglobin Beta expressed in: E.coli

Recombinant Hemoglobin Beta (HBb)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P68871
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 46.0kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Hemoglobin Beta expressed in: E.coli

Recombinant Hemoglobin Beta (HBb)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02088
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.5kDa
  • Isoelectric Point: 6.3
Description: Recombinant Mouse Hemoglobin Beta expressed in: E.coli

Recombinant Hemoglobin Beta (HBb)

  • EUR 368.80
  • EUR 202.00
  • EUR 1108.00
  • EUR 436.00
  • EUR 772.00
  • EUR 310.00
  • EUR 2620.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02075
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.8kDa
  • Isoelectric Point: 6.3
Description: Recombinant Sheep Hemoglobin Beta expressed in: E.coli

HBB Recombinant Protein (Human)

RP014428 100 ug Ask for price

HBB Recombinant Protein (Rat)

RP204251 100 ug Ask for price


STJ150245 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HB in human serum, plasma and other biological fluids

Monoclonal HBB Antibody (monoclonal) (M01), Clone: 2H3

AMM03602G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HBB (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H3. This antibody is applicable in WB, E

Monoclonal HBB Antibody (monoclonal) (M02), Clone: 7B12

AMM03603G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HBB (monoclonal) (M02). The antibodies are raised in mouse and are from clone 7B12. This antibody is applicable in WB and IHC, E

Hemoglobin Subunit Beta 2 (Hbb-b2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with HRP.

Hemoglobin Beta (HBb) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Met1~His147
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Hemoglobin Beta (HBb). This antibody is labeled with PE.

Hemoglobin Beta (HBb) Monoclonal Antibody (Sheep), APC

  • EUR 421.00
  • EUR 4355.00
  • EUR 1182.00
  • EUR 548.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: full length
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with APC.

Hemoglobin Beta (HBb) Monoclonal Antibody (Sheep), Biotinylated

  • EUR 367.00
  • EUR 3252.00
  • EUR 925.00
  • EUR 460.00
  • EUR 243.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: full length
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with Biotin.

Hemoglobin Beta (HBb) Monoclonal Antibody (Sheep), Cy3

  • EUR 519.00
  • EUR 5765.00
  • EUR 1535.00
  • EUR 689.00
  • EUR 294.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: full length
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with Cy3.

Hemoglobin Beta (HBb) Monoclonal Antibody (Sheep), FITC

  • EUR 356.00
  • EUR 3504.00
  • EUR 966.00
  • EUR 458.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: full length
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with FITC.

Hemoglobin Beta (HBb) Monoclonal Antibody (Sheep), HRP

  • EUR 381.00
  • EUR 3791.00
  • EUR 1041.00
  • EUR 491.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: full length
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Sheep Hemoglobin Beta (HBb). This antibody is labeled with HRP.

HBB Rabbit Polyclonal Antibody