CelltaGen
셀타젠 Genetic Genotyping

HBEGF Rabbit Polyclonal Antibody

HBEGF Polyclonal Antibody

29957-50ul 50ul
EUR 187

HBEGF Polyclonal Antibody

A69147 100 ?g
EUR 628.55
Description: kits suitable for this type of research

HBEGF Polyclonal Antibody

ABP58755-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210

HBEGF Polyclonal Antibody

ABP58755-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210

HBEGF Polyclonal Antibody

ABP58755-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210

HBEGF Polyclonal Antibody

ES11256-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HBEGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HBEGF Polyclonal Antibody

ES11256-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HBEGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HBEGF Rabbit pAb

A16365-100ul 100 ul
EUR 308

HBEGF Rabbit pAb

A16365-200ul 200 ul
EUR 459

HBEGF Rabbit pAb

A16365-20ul 20 ul
EUR 183

HBEGF Rabbit pAb

A16365-50ul 50 ul
EUR 223

HBEGF Rabbit pAb

A1695-100ul 100 ul
EUR 308

HBEGF Rabbit pAb

A1695-200ul 200 ul
EUR 459

HBEGF Rabbit pAb

A1695-20ul 20 ul
EUR 183

HBEGF Rabbit pAb

A1695-50ul 50 ul
EUR 223

Polyclonal HBEGF Antibody (Center)

APR04021G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HBEGF (Center). This antibody is tested and proven to work in the following applications:

HBEGF Polyclonal Conjugated Antibody

C29821 100ul
EUR 397

HBEGF Polyclonal Conjugated Antibody

C29957 100ul
EUR 397

HBEGF Polyclonal Antibody, HRP Conjugated

A69148 100 ?g
EUR 628.55
Description: fast delivery possible

HBEGF Polyclonal Antibody, FITC Conjugated

A69149 100 ?g
EUR 628.55
Description: reagents widely cited

HBEGF Polyclonal Antibody, Biotin Conjugated

A69150 100 ?g
EUR 628.55
Description: Ask the seller for details

HBEGF Antibody

1-CSB-PA857429LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

DLR-HBEGF-Hu-48T 48T
EUR 388
  • Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

DLR-HBEGF-Hu-96T 96T
EUR 496
  • Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

DLR-HBEGF-Mu-48T 48T
EUR 396
  • Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

DLR-HBEGF-Mu-96T 96T
EUR 508
  • Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

DLR-HBEGF-Ra-48T 48T
EUR 413
  • Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

DLR-HBEGF-Ra-96T 96T
EUR 531
  • Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RDR-HBEGF-Hu-48Tests 48 Tests
EUR 391

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RDR-HBEGF-Hu-96Tests 96 Tests
EUR 538

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RDR-HBEGF-Mu-48Tests 48 Tests
EUR 402

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RDR-HBEGF-Mu-96Tests 96 Tests
EUR 552

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RDR-HBEGF-Ra-48Tests 48 Tests
EUR 422

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RDR-HBEGF-Ra-96Tests 96 Tests
EUR 581

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RD-HBEGF-Hu-48Tests 48 Tests
EUR 375

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RD-HBEGF-Hu-96Tests 96 Tests
EUR 515

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RD-HBEGF-Mu-48Tests 48 Tests
EUR 385

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RD-HBEGF-Mu-96Tests 96 Tests
EUR 528

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RD-HBEGF-Ra-48Tests 48 Tests
EUR 404

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit

RD-HBEGF-Ra-96Tests 96 Tests
EUR 556

Anti-HBEGF antibody

STJ27528 100 µl
EUR 277

Anti-HBEGF antibody

STJ118805 100 µl
EUR 277

Anti-HBEGF antibody

STJ192414 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HBEGF

HBEGF Protein

20-abx260393
  • EUR 230.00
  • EUR 1970.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HBEGF Protein

20-abx261848
  • EUR 328.00
  • EUR 4448.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

HBEGF Protein

20-abx263497
  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HBEGF Protein

20-abx263499
  • EUR 230.00
  • EUR 1790.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.

HBEGF siRNA

20-abx902420
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HBEGF siRNA

20-abx919127
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HBEGF siRNA

20-abx919128
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HBEGF Antibody, HRP conjugated

1-CSB-PA857429LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HBEGF Antibody, FITC conjugated

1-CSB-PA857429LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HBEGF Antibody, Biotin conjugated

1-CSB-PA857429LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HBEGF cloning plasmid

CSB-CL857429HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: atgaagctgctgccgtcggtggtgctgaagctctttctggctgcagttctctcggcactggtgactggcgagagcctggagcggcttcggagagggctagctgctggaaccagcaacccggaccctcccactgtatccacggaccagctgctacccctaggaggcggccgggaccg
  • Show more
Description: A cloning plasmid for the HBEGF gene.

HBEGF protein (His tag)

80R-2915 50 ug
EUR 327
Description: Purified recombinant HBEGF protein (His tag)

HBEGF protein (His tag)

80R-3462 50 ug
EUR 257
Description: Purified recombinant HBEGF protein (His tag)

Human HBEGF ELISA Kit

ELA-E1479h 96 Tests
EUR 824

Anserini HBEGF ELISA Kit

EAH0045 96Tests
EUR 521

HBEGF ELISA KIT|Human

EF000129 96 Tests
EUR 689

Chicken HBEGF ELISA Kit

ELI-04850c 96 Tests
EUR 928

Rat HBEGF shRNA Plasmid

20-abx985022
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HBEGF shRNA Plasmid

20-abx951287
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HBEGF shRNA Plasmid

20-abx970775
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HBEGF ELISA kit

LF-EK50781 1×96T
EUR 648

Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit

E04H1364-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit

E04H1364-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit

E04H1364-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

HBEGF protein (Mouse) (His tag)

80R-3461 50 ug
EUR 257
Description: Purified recombinant HBEGF protein (Mouse) (His tag)

ELISA kit for Human HBEGF

EK5330 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human HBEGF in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HBEGF PicoKine ELISA Kit

EK0770 96 wells
EUR 425
Description: For quantitative detection of human HBEGF in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Hbegf ORF Vector (Rat) (pORF)

ORF068089 1.0 ug DNA
EUR 506

h HBEGF inducible lentiviral particles

LVP721 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h HBEGF (heparin-binding EGF-like growth factor), [alternative names: DTR; DTS; DTSF; HEGFL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001945. It also contains a RFP-Blasticidin dual selection marker.

HBEGF ORF Vector (Human) (pORF)

ORF004813 1.0 ug DNA
EUR 95

Hbegf ORF Vector (Mouse) (pORF)

ORF047006 1.0 ug DNA
EUR 506

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human)

4-PAB479Hu01
  • EUR 217.00
  • EUR 2048.00
  • EUR 520.00
  • EUR 268.00
  • EUR 201.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF)

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse)

4-PAB479Mu01
  • EUR 221.00
  • EUR 2100.00
  • EUR 532.00
  • EUR 272.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF)

Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody

20-abx006691
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody

abx028334-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody

abx028334-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody

20-abx333738
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), APC

4-PAB479Hu01-APC
  • EUR 301.00
  • EUR 2645.00
  • EUR 755.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Biotinylated

4-PAB479Hu01-Biotin
  • EUR 279.00
  • EUR 1998.00
  • EUR 612.00
  • EUR 334.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Cy3

4-PAB479Hu01-Cy3
  • EUR 360.00
  • EUR 3485.00
  • EUR 965.00
  • EUR 461.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), FITC

4-PAB479Hu01-FITC
  • EUR 261.00
  • EUR 2136.00
  • EUR 624.00
  • EUR 321.00
  • EUR 180.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), HRP

4-PAB479Hu01-HRP
  • EUR 277.00
  • EUR 2309.00
  • EUR 671.00
  • EUR 343.00
  • EUR 190.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), PE

4-PAB479Hu01-PE
  • EUR 261.00
  • EUR 2136.00
  • EUR 624.00
  • EUR 321.00
  • EUR 180.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), APC

4-PAB479Mu01-APC
  • EUR 306.00
  • EUR 2717.00
  • EUR 773.00
  • EUR 384.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Biotinylated

4-PAB479Mu01-Biotin
  • EUR 283.00
  • EUR 2050.00
  • EUR 625.00
  • EUR 340.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Cy3

4-PAB479Mu01-Cy3
  • EUR 367.00
  • EUR 3581.00
  • EUR 989.00
  • EUR 470.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), FITC

4-PAB479Mu01-FITC
  • EUR 265.00
  • EUR 2193.00
  • EUR 638.00
  • EUR 327.00
  • EUR 181.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), HRP

4-PAB479Mu01-HRP
  • EUR 282.00
  • EUR 2371.00
  • EUR 686.00
  • EUR 349.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), PE

4-PAB479Mu01-PE
  • EUR 265.00
  • EUR 2193.00
  • EUR 638.00
  • EUR 327.00
  • EUR 181.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE.

Hbegf sgRNA CRISPR Lentivector set (Rat)

K7619701 3 x 1.0 ug
EUR 339

Hbegf sgRNA CRISPR Lentivector set (Mouse)

K3988501 3 x 1.0 ug
EUR 339

HBEGF sgRNA CRISPR Lentivector set (Human)

K0932001 3 x 1.0 ug
EUR 339

Human HBEGF ELISA kit (4×96T)

LF-EK50782 4×96T
EUR 2201

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody (HRP)

20-abx337189
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody (FITC)

20-abx337190
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody (Biotin)

20-abx337191
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), APC-Cy7

4-PAB479Hu01-APC-Cy7
  • EUR 482.00
  • EUR 5170.00
  • EUR 1390.00
  • EUR 634.00
  • EUR 281.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Val21~Thr160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC-Cy7.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), APC-Cy7

4-PAB479Mu01-APC-Cy7
  • EUR 493.00
  • EUR 5314.00
  • EUR 1426.00
  • EUR 648.00
  • EUR 284.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HBEGF (Ser25~Thr160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC-Cy7.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

HBEGF Rabbit Polyclonal Antibody