HBEGF Rabbit Polyclonal Antibody

HBEGF Polyclonal Antibody
29957-50ul	SAB	50ul	EUR 187

HBEGF Polyclonal Antibody
A69147	EpiGentek	100 ?g	EUR 628.55
Description: kits suitable for this type of research

HBEGF Polyclonal Antibody
ABP58755-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210

HBEGF Polyclonal Antibody
ABP58755-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210

HBEGF Polyclonal Antibody
ABP58755-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of HBEGF from Human, Mouse, Rat. This HBEGF antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HBEGF protein at amino acid sequence of 130-210

HBEGF Polyclonal Antibody
ES11256-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HBEGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HBEGF Polyclonal Antibody
ES11256-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HBEGF from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HBEGF Rabbit pAb
A16365-100ul	Abclonal	100 ul	EUR 308

HBEGF Rabbit pAb
A16365-200ul	Abclonal	200 ul	EUR 459

HBEGF Rabbit pAb
A16365-20ul	Abclonal	20 ul	EUR 183

HBEGF Rabbit pAb
A16365-50ul	Abclonal	50 ul	EUR 223

HBEGF Rabbit pAb
A1695-100ul	Abclonal	100 ul	EUR 308

HBEGF Rabbit pAb
A1695-200ul	Abclonal	200 ul	EUR 459

HBEGF Rabbit pAb
A1695-20ul	Abclonal	20 ul	EUR 183

HBEGF Rabbit pAb
A1695-50ul	Abclonal	50 ul	EUR 223

Polyclonal HBEGF Antibody (Center)
APR04021G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HBEGF (Center). This antibody is tested and proven to work in the following applications:

HBEGF Polyclonal Conjugated Antibody
C29821	SAB	100ul	EUR 397

HBEGF Polyclonal Conjugated Antibody
C29957	SAB	100ul	EUR 397

HBEGF Polyclonal Antibody, HRP Conjugated
A69148	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

HBEGF Polyclonal Antibody, FITC Conjugated
A69149	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

HBEGF Polyclonal Antibody, Biotin Conjugated
A69150	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

HBEGF Antibody
1-CSB-PA857429LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:20-1:200

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
DLR-HBEGF-Hu-48T	DL Develop	48T	EUR 388
Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
DLR-HBEGF-Hu-96T	DL Develop	96T	EUR 496
Should the Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
DLR-HBEGF-Mu-48T	DL Develop	48T	EUR 396
Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
DLR-HBEGF-Mu-96T	DL Develop	96T	EUR 508
Should the Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
DLR-HBEGF-Ra-48T	DL Develop	48T	EUR 413
Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
DLR-HBEGF-Ra-96T	DL Develop	96T	EUR 531
Should the Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 391

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 538

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 402

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 552

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Ra-48Tests	Reddot Biotech	48 Tests	EUR 422

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RDR-HBEGF-Ra-96Tests	Reddot Biotech	96 Tests	EUR 581

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 375

Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 515

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 385

Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 528

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Ra-48Tests	Reddot Biotech	48 Tests	EUR 404

Rat Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) ELISA Kit
RD-HBEGF-Ra-96Tests	Reddot Biotech	96 Tests	EUR 556

Anti-HBEGF antibody
STJ27528	St John's Laboratory	100 µl	EUR 277

Anti-HBEGF antibody
STJ118805	St John's Laboratory	100 µl	EUR 277

Anti-HBEGF antibody
STJ192414	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to HBEGF

HBEGF Protein
20-abx260393	Abbexa	EUR 230.00 EUR 1970.00 EUR 328.00	10 ug 1 mg 50 ug
Shipped within 5-10 working days.

HBEGF Protein
20-abx261848	Abbexa	EUR 328.00 EUR 4448.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

HBEGF Protein
20-abx263497	Abbexa	EUR 230.00 EUR 1790.00 EUR 328.00	10 ug 1 mg 50 ug
Shipped within 5-10 working days.

HBEGF Protein
20-abx263499	Abbexa	EUR 230.00 EUR 1790.00 EUR 328.00	10 ug 1 mg 50 ug
Shipped within 5-10 working days.

HBEGF siRNA
20-abx902420	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HBEGF siRNA
20-abx919127	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HBEGF siRNA
20-abx919128	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HBEGF Antibody, HRP conjugated
1-CSB-PA857429LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HBEGF Antibody, FITC conjugated
1-CSB-PA857429LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HBEGF Antibody, Biotin conjugated
1-CSB-PA857429LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HBEGF. Recognizes HBEGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HBEGF cloning plasmid
CSB-CL857429HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 627 Sequence: atgaagctgctgccgtcggtggtgctgaagctctttctggctgcagttctctcggcactggtgactggcgagagcctggagcggcttcggagagggctagctgctggaaccagcaacccggaccctcccactgtatccacggaccagctgctacccctaggaggcggccgggaccg Show more
Description: A cloning plasmid for the HBEGF gene.

HBEGF protein (His tag)
80R-2915	Fitzgerald	50 ug	EUR 327
Description: Purified recombinant HBEGF protein (His tag)

HBEGF protein (His tag)
80R-3462	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant HBEGF protein (His tag)

Human HBEGF ELISA Kit
ELA-E1479h	Lifescience Market	96 Tests	EUR 824

Anserini HBEGF ELISA Kit
EAH0045	Abclonal	96Tests	EUR 521

HBEGF ELISA KIT|Human
EF000129	Lifescience Market	96 Tests	EUR 689

Chicken HBEGF ELISA Kit
ELI-04850c	Lifescience Market	96 Tests	EUR 928

Rat HBEGF shRNA Plasmid
20-abx985022	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HBEGF shRNA Plasmid
20-abx951287	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HBEGF shRNA Plasmid
20-abx970775	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HBEGF ELISA kit
LF-EK50781	Abfrontier	1×96T	EUR 648

Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit
E04H1364-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit
E04H1364-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit heparin binding EGF like growth factor (HBEGF) ELISA kit
E04H1364-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit heparin binding EGF like growth factor (HBEGF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

HBEGF protein (Mouse) (His tag)
80R-3461	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant HBEGF protein (Mouse) (His tag)

ELISA kit for Human HBEGF
EK5330	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human HBEGF in samples from serum, plasma, tissue homogenates and other biological fluids.

Human HBEGF PicoKine ELISA Kit
EK0770	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human HBEGF in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Hbegf ORF Vector (Rat) (pORF)
ORF068089	ABM	1.0 ug DNA	EUR 506

h HBEGF inducible lentiviral particles
LVP721	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h HBEGF (heparin-binding EGF-like growth factor), [alternative names: DTR; DTS; DTSF; HEGFL]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001945. It also contains a RFP-Blasticidin dual selection marker.

HBEGF ORF Vector (Human) (pORF)
ORF004813	ABM	1.0 ug DNA	EUR 95

Hbegf ORF Vector (Mouse) (pORF)
ORF047006	ABM	1.0 ug DNA	EUR 506

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human)
4-PAB479Hu01	Cloud-Clone	EUR 217.00 EUR 2048.00 EUR 520.00 EUR 268.00 EUR 201.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF)

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse)
4-PAB479Mu01	Cloud-Clone	EUR 221.00 EUR 2100.00 EUR 532.00 EUR 272.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF)

Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody
20-abx006691	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody
abx028334-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Proheparin-Binding EGF-Like Growth Factor (HBEGF) Antibody
abx028334-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody
20-abx333738	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), APC
4-PAB479Hu01-APC	Cloud-Clone	EUR 301.00 EUR 2645.00 EUR 755.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Biotinylated
4-PAB479Hu01-Biotin	Cloud-Clone	EUR 279.00 EUR 1998.00 EUR 612.00 EUR 334.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), Cy3
4-PAB479Hu01-Cy3	Cloud-Clone	EUR 360.00 EUR 3485.00 EUR 965.00 EUR 461.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), FITC
4-PAB479Hu01-FITC	Cloud-Clone	EUR 261.00 EUR 2136.00 EUR 624.00 EUR 321.00 EUR 180.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), HRP
4-PAB479Hu01-HRP	Cloud-Clone	EUR 277.00 EUR 2309.00 EUR 671.00 EUR 343.00 EUR 190.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), PE
4-PAB479Hu01-PE	Cloud-Clone	EUR 261.00 EUR 2136.00 EUR 624.00 EUR 321.00 EUR 180.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), APC
4-PAB479Mu01-APC	Cloud-Clone	EUR 306.00 EUR 2717.00 EUR 773.00 EUR 384.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Biotinylated
4-PAB479Mu01-Biotin	Cloud-Clone	EUR 283.00 EUR 2050.00 EUR 625.00 EUR 340.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Biotin.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), Cy3
4-PAB479Mu01-Cy3	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with Cy3.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), FITC
4-PAB479Mu01-FITC	Cloud-Clone	EUR 265.00 EUR 2193.00 EUR 638.00 EUR 327.00 EUR 181.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with FITC.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), HRP
4-PAB479Mu01-HRP	Cloud-Clone	EUR 282.00 EUR 2371.00 EUR 686.00 EUR 349.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with HRP.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), PE
4-PAB479Mu01-PE	Cloud-Clone	EUR 265.00 EUR 2193.00 EUR 638.00 EUR 327.00 EUR 181.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with PE.

Hbegf sgRNA CRISPR Lentivector set (Rat)
K7619701	ABM	3 x 1.0 ug	EUR 339

Hbegf sgRNA CRISPR Lentivector set (Mouse)
K3988501	ABM	3 x 1.0 ug	EUR 339

HBEGF sgRNA CRISPR Lentivector set (Human)
K0932001	ABM	3 x 1.0 ug	EUR 339

Human HBEGF ELISA kit (4×96T)
LF-EK50782	Abfrontier	4×96T	EUR 2201

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody (HRP)
20-abx337189	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody (FITC)
20-abx337190	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Heparin Binding EGF Like Growth Factor (HBEGF) Antibody (Biotin)
20-abx337191	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Human), APC-Cy7
4-PAB479Hu01-APC-Cy7	Cloud-Clone	EUR 482.00 EUR 5170.00 EUR 1390.00 EUR 634.00 EUR 281.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Val21~Thr160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC-Cy7.

Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB479Mu01-APC-Cy7	Cloud-Clone	EUR 493.00 EUR 5314.00 EUR 1426.00 EUR 648.00 EUR 284.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HBEGF (Ser25~Thr160) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Heparin Binding Epidermal Growth Factor Like Growth Factor (HBEGF). This antibody is labeled with APC-Cy7.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

HBEGF Rabbit Polyclonal Antibody