ID3 Rabbit Polyclonal Antibody
ID3 Polyclonal Antibody |
ABP58864-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
- Applications tips:
|
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117 |
ID3 Polyclonal Antibody |
ABP58864-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
- Applications tips:
|
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117 |
ID3 Polyclonal Antibody |
ABP58864-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
- Applications tips:
|
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117 |
ID3 Rabbit pAb |
A5375-100ul |
Abclonal |
100 ul |
EUR 308 |
ID3 Rabbit pAb |
A5375-200ul |
Abclonal |
200 ul |
EUR 459 |
ID3 Rabbit pAb |
A5375-20ul |
Abclonal |
20 ul |
EUR 183 |
ID3 Rabbit pAb |
A5375-50ul |
Abclonal |
50 ul |
EUR 223 |
ID3 Antibody |
37640-100ul |
SAB |
100ul |
EUR 252 |
ID3 antibody |
38647-100ul |
SAB |
100ul |
EUR 252 |
ID3 antibody |
10R-4417 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4418 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4419 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4420 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4421 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4422 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4423 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
10R-4424 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal ID3 antibody |
ID3 Antibody |
DF12520 |
Affbiotech |
200ul |
EUR 304 |
Description: ID3 Antibody detects endogenous levels of ID3. |
ID3 Antibody |
DF12640 |
Affbiotech |
200ul |
EUR 304 |
Description: ID3 Antibody detects endogenous levels of ID3. |
ID3 Antibody |
1-CSB-PA576712 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
ID3 Antibody |
1-CSB-PA01959A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
Polyclonal ID3 Antibody (C-Terminus) |
APR02577G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
ID3 Conjugated Antibody |
C37640 |
SAB |
100ul |
EUR 397 |
anti- ID3 antibody |
FNab04115 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:100
- Immunogen: inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
- Uniprot ID: Q02535
- Gene ID: 3399
- Research Area: Neuroscience, Metabolism, Developmental bi
- Show more
|
Description: Antibody raised against ID3 |
Anti-ID3 antibody |
STJ27328 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. |
Anti-ID3 antibody |
STJ192556 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ID3 |
ID3 siRNA |
20-abx902601 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ID3 siRNA |
20-abx920133 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ID3 siRNA |
20-abx920134 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ID3 |
YF-PA12524 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to ID3 |
anti-ID3 |
YF-PA12525 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ID3 |
anti-ID3 |
YF-PA23944 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to ID3 |
ID3 Antibody, HRP conjugated |
1-CSB-PA01959B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ID3 Antibody, FITC conjugated |
1-CSB-PA01959C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ID3 Antibody, Biotin conjugated |
1-CSB-PA01959D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ID3 cloning plasmid |
CSB-CL010969HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 360
- Sequence: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtccc
- Show more
|
Description: A cloning plasmid for the ID3 gene. |
ID3 Blocking Peptide |
DF12520-BP |
Affbiotech |
1mg |
EUR 195 |
ID3 Blocking Peptide |
DF12640-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-ID3 (4G1) |
YF-MA13639 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID3 |
Anti-ID3 (3E10) |
YF-MA13640 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID3 |
Anti-ID3 (2H8) |
YF-MA13641 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID3 |
Anti-ID3 (3D3) |
YF-MA13642 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ID3 |
Rat ID3 shRNA Plasmid |
20-abx985140 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ID3 shRNA Plasmid |
20-abx970960 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ID3 shRNA Plasmid |
20-abx952309 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ID3 Recombinant Protein (Human) |
RP015532 |
ABM |
100 ug |
Ask for price |
ID3 Recombinant Protein (Rat) |
RP205436 |
ABM |
100 ug |
Ask for price |
ID3 Recombinant Protein (Mouse) |
RP142880 |
ABM |
100 ug |
Ask for price |
Monoclonal ID3 Antibody (monoclonal) (M02), Clone: 3E11 |
AMM03649G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E |
Monoclonal ID3 Antibody (monoclonal) (M03), Clone: 2H8 |
AMM03650G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2H8. This antibody is applicable in WB and IF, E |
ID3 ORF Vector (Human) (pORF) |
ORF005178 |
ABM |
1.0 ug DNA |
EUR 95 |
Id3 ORF Vector (Rat) (pORF) |
ORF068480 |
ABM |
1.0 ug DNA |
EUR 506 |
Id3 ORF Vector (Mouse) (pORF) |
ORF047628 |
ABM |
1.0 ug DNA |
EUR 95 |
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
20-abx004116 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
abx030201-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
abx030201-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
20-abx333779 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
20-abx241670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
abx234115-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
ID3 sgRNA CRISPR Lentivector set (Human) |
K1012601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Id3 sgRNA CRISPR Lentivector set (Mouse) |
K4367101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Id3 sgRNA CRISPR Lentivector set (Rat) |
K6825601 |
ABM |
3 x 1.0 ug |
EUR 339 |
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (HRP) |
20-abx335424 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (FITC) |
20-abx335425 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (Biotin) |
20-abx335426 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ID3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1012602 |
ABM |
1.0 ug DNA |
EUR 154 |
ID3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1012603 |
ABM |
1.0 ug DNA |
EUR 154 |
ID3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1012604 |
ABM |
1.0 ug DNA |
EUR 154 |
Id3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4367102 |
ABM |
1.0 ug DNA |
EUR 154 |
Id3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4367103 |
ABM |
1.0 ug DNA |
EUR 154 |
Id3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4367104 |
ABM |
1.0 ug DNA |
EUR 154 |
Id3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6825602 |
ABM |
1.0 ug DNA |
EUR 154 |
Id3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6825603 |
ABM |
1.0 ug DNA |
EUR 154 |
Id3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6825604 |
ABM |
1.0 ug DNA |
EUR 154 |
ID3 Protein Vector (Rat) (pPB-C-His) |
PV273918 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Rat) (pPB-N-His) |
PV273919 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Rat) (pPM-C-HA) |
PV273920 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Rat) (pPM-C-His) |
PV273921 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Human) (pPB-C-His) |
PV020709 |
ABM |
500 ng |
EUR 329 |
ID3 Protein Vector (Human) (pPB-N-His) |
PV020710 |
ABM |
500 ng |
EUR 329 |
ID3 Protein Vector (Human) (pPM-C-HA) |
PV020711 |
ABM |
500 ng |
EUR 329 |
ID3 Protein Vector (Human) (pPM-C-His) |
PV020712 |
ABM |
500 ng |
EUR 329 |
ID3 Protein Vector (Mouse) (pPB-C-His) |
PV190510 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Mouse) (pPB-N-His) |
PV190511 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Mouse) (pPM-C-HA) |
PV190512 |
ABM |
500 ng |
EUR 603 |
ID3 Protein Vector (Mouse) (pPM-C-His) |
PV190513 |
ABM |
500 ng |
EUR 603 |
Id3 3'UTR Luciferase Stable Cell Line |
TU206079 |
ABM |
1.0 ml |
Ask for price |
Id3 3'UTR GFP Stable Cell Line |
TU159876 |
ABM |
1.0 ml |
Ask for price |
ID3 3'UTR Luciferase Stable Cell Line |
TU010403 |
ABM |
1.0 ml |
EUR 1394 |
Id3 3'UTR Luciferase Stable Cell Line |
TU109876 |
ABM |
1.0 ml |
Ask for price |
ID3 3'UTR GFP Stable Cell Line |
TU060403 |
ABM |
1.0 ml |
EUR 1394 |
Id3 3'UTR GFP Stable Cell Line |
TU256079 |
ABM |
1.0 ml |
Ask for price |
ID3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV673651 |
ABM |
1.0 ug DNA |
EUR 514 |
ID3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV673655 |
ABM |
1.0 ug DNA |
EUR 514 |
ID3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV673656 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ID3 Rabbit Polyclonal Antibody