ID3 Rabbit Polyclonal Antibody
 ID3 Polyclonal Antibody |
|
ABP58864-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117 |
ID3 Polyclonal Antibody |
|
ES11398-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ID3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ID3 Polyclonal Antibody |
|
ES11398-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ID3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ID3 Rabbit pAb |
|
A5375-100ul |
Abclonal |
100 ul |
EUR 308 |
ID3 Rabbit pAb |
|
A5375-200ul |
Abclonal |
200 ul |
EUR 459 |
ID3 Rabbit pAb |
|
A5375-20ul |
Abclonal |
20 ul |
EUR 183 |
ID3 Rabbit pAb |
|
A5375-50ul |
Abclonal |
50 ul |
EUR 223 |
 ID3 Antibody |
|
37640-100ul |
SAB |
100ul |
EUR 252 |
 ID3 antibody |
|
38647-100ul |
SAB |
100ul |
EUR 252 |
ID3 antibody |
|
10R-4417 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4418 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4419 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4420 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4421 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4422 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4423 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 antibody |
|
10R-4424 |
Fitzgerald |
100 ul |
EUR 726 |
|
Description: Mouse monoclonal ID3 antibody |
ID3 Antibody |
|
DF12640 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ID3 Antibody detects endogenous levels of ID3. |
ID3 Antibody |
|
DF12520 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ID3 Antibody detects endogenous levels of ID3. |
ID3 Antibody |
|
1-CSB-PA576712 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
ID3 Antibody |
|
1-CSB-PA01959A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
) Polyclonal ID3 Antibody (C-Terminus) |
|
APR02577G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
 ID3 Conjugated Antibody |
|
C37640 |
SAB |
100ul |
EUR 397 |
 anti- ID3 antibody |
|
FNab04115 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:100
- Immunogen: inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
- Uniprot ID: Q02535
- Gene ID: 3399
- Research Area: Neuroscience, Metabolism, Developmental bi
- Show more
|
|
Description: Antibody raised against ID3 |
 Anti-ID3 antibody |
|
STJ27328 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts. |
Anti-ID3 antibody |
|
STJ192556 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ID3 |
 ID3 siRNA |
|
20-abx902601 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ID3 siRNA |
|
20-abx920133 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ID3 siRNA |
|
20-abx920134 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ID3 |
|
YF-PA12524 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ID3 |
anti-ID3 |
|
YF-PA12525 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ID3 |
anti-ID3 |
|
YF-PA23944 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to ID3 |
 ID3 Antibody, HRP conjugated |
|
1-CSB-PA01959B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 ID3 Antibody, FITC conjugated |
|
1-CSB-PA01959C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 ID3 Antibody, Biotin conjugated |
|
1-CSB-PA01959D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ID3 Blocking Peptide |
|
DF12640-BP |
Affbiotech |
1mg |
EUR 195 |
ID3 Blocking Peptide |
|
DF12520-BP |
Affbiotech |
1mg |
EUR 195 |
 ID3 cloning plasmid |
|
CSB-CL010969HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 360
- Sequence: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtccc
- Show more
|
|
Description: A cloning plasmid for the ID3 gene. |
) Anti-ID3 (4G1) |
|
YF-MA13639 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ID3 |
) Anti-ID3 (3E10) |
|
YF-MA13640 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ID3 |
) Anti-ID3 (2H8) |
|
YF-MA13641 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ID3 |
) Anti-ID3 (3D3) |
|
YF-MA13642 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ID3 |
 Rat ID3 shRNA Plasmid |
|
20-abx985140 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ID3 shRNA Plasmid |
|
20-abx952309 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse ID3 shRNA Plasmid |
|
20-abx970960 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ID3 Recombinant Protein (Human) |
|
RP015532 |
ABM |
100 ug |
Ask for price |
) ID3 Recombinant Protein (Rat) |
|
RP205436 |
ABM |
100 ug |
Ask for price |
) ID3 Recombinant Protein (Mouse) |
|
RP142880 |
ABM |
100 ug |
Ask for price |
 (M02), Clone: 3E11) Monoclonal ID3 Antibody (monoclonal) (M02), Clone: 3E11 |
|
AMM03649G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E |
 (M03), Clone: 2H8) Monoclonal ID3 Antibody (monoclonal) (M03), Clone: 2H8 |
|
AMM03650G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2H8. This antibody is applicable in WB and IF, E |
 (pORF)) Id3 ORF Vector (Rat) (pORF) |
|
ORF068480 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ID3 ORF Vector (Human) (pORF) |
|
ORF005178 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Id3 ORF Vector (Mouse) (pORF) |
|
ORF047628 |
ABM |
1.0 ug DNA |
EUR 95 |
 Antibody) DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
|
20-abx004116 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
|
abx030201-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
|
abx030201-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
|
20-abx241670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
|
abx234115-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody |
|
20-abx333779 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
) Id3 sgRNA CRISPR Lentivector set (Rat) |
|
K6825601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Id3 sgRNA CRISPR Lentivector set (Mouse) |
|
K4367101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ID3 sgRNA CRISPR Lentivector set (Human) |
|
K1012601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody (HRP)) DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (HRP) |
|
20-abx335424 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (FITC) |
|
20-abx335425 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (Biotin) |
|
20-abx335426 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (Target 1)) Id3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6825602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Id3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6825603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Id3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6825604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Id3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4367102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Id3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4367103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Id3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4367104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) ID3 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1012602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ID3 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1012603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ID3 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1012604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) ID3 Protein Vector (Human) (pPB-C-His) |
|
PV020709 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ID3 Protein Vector (Human) (pPB-N-His) |
|
PV020710 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ID3 Protein Vector (Human) (pPM-C-HA) |
|
PV020711 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ID3 Protein Vector (Human) (pPM-C-His) |
|
PV020712 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ID3 Protein Vector (Rat) (pPB-C-His) |
|
PV273918 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ID3 Protein Vector (Rat) (pPB-N-His) |
|
PV273919 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ID3 Protein Vector (Rat) (pPM-C-HA) |
|
PV273920 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ID3 Protein Vector (Rat) (pPM-C-His) |
|
PV273921 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ID3 Protein Vector (Mouse) (pPB-C-His) |
|
PV190510 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ID3 Protein Vector (Mouse) (pPB-N-His) |
|
PV190511 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ID3 Protein Vector (Mouse) (pPM-C-HA) |
|
PV190512 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ID3 Protein Vector (Mouse) (pPM-C-His) |
|
PV190513 |
ABM |
500 ng |
EUR 603 |
 Id3 3'UTR Luciferase Stable Cell Line |
|
TU109876 |
ABM |
1.0 ml |
Ask for price |
Id3 3'UTR Luciferase Stable Cell Line |
|
TU206079 |
ABM |
1.0 ml |
Ask for price |
 Id3 3'UTR GFP Stable Cell Line |
|
TU159876 |
ABM |
1.0 ml |
Ask for price |
Id3 3'UTR GFP Stable Cell Line |
|
TU256079 |
ABM |
1.0 ml |
Ask for price |
 ID3 3'UTR GFP Stable Cell Line |
|
TU060403 |
ABM |
1.0 ml |
EUR 1394 |
 ID3 3'UTR Luciferase Stable Cell Line |
|
TU010403 |
ABM |
1.0 ml |
EUR 1394 |
 (CMV) (pLenti-GIII-CMV)) ID3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV673651 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) ID3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV673655 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) ID3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV673656 |
ABM |
1.0 ug DNA |
EUR 514 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
ID3 Rabbit Polyclonal Antibody
