셀타젠 Genetic Genotyping

ID3 Rabbit Polyclonal Antibody

ID3 Polyclonal Antibody

ABP58864-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
  • Applications tips:
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117

ID3 Polyclonal Antibody

ABP58864-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
  • Applications tips:
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117

ID3 Polyclonal Antibody

ABP58864-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
  • Applications tips:
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117

ID3 Rabbit pAb

A5375-100ul 100 ul
EUR 308

ID3 Rabbit pAb

A5375-200ul 200 ul
EUR 459

ID3 Rabbit pAb

A5375-20ul 20 ul
EUR 183

ID3 Rabbit pAb

A5375-50ul 50 ul
EUR 223

ID3 Antibody

ABF9263 100 ug
EUR 438

ID3 Antibody

37640-100ul 100ul
EUR 252

ID3 antibody

38647-100ul 100ul
EUR 252

ID3 antibody

10R-4417 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4418 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4419 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4420 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4421 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4422 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4423 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4424 100 ul
EUR 726
Description: Mouse monoclonal ID3 antibody

ID3 Antibody

DF12520 200ul
EUR 304
Description: ID3 Antibody detects endogenous levels of ID3.

ID3 Antibody

DF12640 200ul
EUR 304
Description: ID3 Antibody detects endogenous levels of ID3.

ID3 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ID3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal ID3 Antibody (C-Terminus)

APR02577G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID3 (C-Terminus). This antibody is tested and proven to work in the following applications:

Id3/ Rat Id3 ELISA Kit

ELI-08420r 96 Tests
EUR 886

ID3 Conjugated Antibody

C37640 100ul
EUR 397

anti- ID3 antibody

FNab04115 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
  • Uniprot ID: Q02535
  • Gene ID: 3399
  • Research Area: Neuroscience, Metabolism, Developmental bi
  • Show more
Description: Antibody raised against ID3

Anti-ID3 antibody

PAab04115 100 ug
EUR 355

Anti-ID3 antibody

STJ27328 100 µl
EUR 277
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts.

Anti-ID3 antibody

STJ192556 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ID3


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12524 50 ul
EUR 363
Description: Mouse polyclonal to ID3


YF-PA12525 50 ug
EUR 363
Description: Mouse polyclonal to ID3


YF-PA23944 50 ul
EUR 334
Description: Mouse polyclonal to ID3

ID3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ID3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ID3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ID3 cloning plasmid

CSB-CL010969HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 360
  • Sequence: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtccc
  • Show more
Description: A cloning plasmid for the ID3 gene.

ID3 Blocking Peptide

DF12520-BP 1mg
EUR 195

ID3 Blocking Peptide

DF12640-BP 1mg
EUR 195

Anti-ID3 (4G1)

YF-MA13639 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Anti-ID3 (3E10)

YF-MA13640 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Anti-ID3 (2H8)

YF-MA13641 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Anti-ID3 (3D3)

YF-MA13642 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Rat ID3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF010278 96 Tests
EUR 689


ELI-31093d 96 Tests
EUR 928

Mouse ID3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ID3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ID3 Recombinant Protein (Human)

RP015532 100 ug Ask for price

ID3 Recombinant Protein (Rat)

RP205436 100 ug Ask for price

ID3 Recombinant Protein (Mouse)

RP142880 100 ug Ask for price

Monoclonal ID3 Antibody (monoclonal) (M02), Clone: 3E11

AMM03649G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E

Monoclonal ID3 Antibody (monoclonal) (M03), Clone: 2H8

AMM03650G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2H8. This antibody is applicable in WB and IF, E

ID3 ORF Vector (Human) (pORF)

ORF005178 1.0 ug DNA
EUR 95

Id3 ORF Vector (Rat) (pORF)

ORF068480 1.0 ug DNA
EUR 506

Id3 ORF Vector (Mouse) (pORF)

ORF047628 1.0 ug DNA
EUR 95

pECMV-Id3-m-FLAG Plasmid

PVT15045 2 ug
EUR 325

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

abx030201-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

abx030201-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

abx234115-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

ID3 sgRNA CRISPR Lentivector set (Human)

K1012601 3 x 1.0 ug
EUR 339

Id3 sgRNA CRISPR Lentivector set (Mouse)

K4367101 3 x 1.0 ug
EUR 339

Id3 sgRNA CRISPR Lentivector set (Rat)

K6825601 3 x 1.0 ug
EUR 339

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ID3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1012602 1.0 ug DNA
EUR 154

ID3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1012603 1.0 ug DNA
EUR 154

ID3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1012604 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4367102 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4367103 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4367104 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6825602 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6825603 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6825604 1.0 ug DNA
EUR 154

ID3 Protein Vector (Rat) (pPB-C-His)

PV273918 500 ng
EUR 603

ID3 Protein Vector (Rat) (pPB-N-His)

PV273919 500 ng
EUR 603

ID3 Protein Vector (Rat) (pPM-C-HA)

PV273920 500 ng
EUR 603

ID3 Protein Vector (Rat) (pPM-C-His)

PV273921 500 ng
EUR 603

ID3 Protein Vector (Human) (pPB-C-His)

PV020709 500 ng
EUR 329

ID3 Protein Vector (Human) (pPB-N-His)

PV020710 500 ng
EUR 329

ID3 Protein Vector (Human) (pPM-C-HA)

PV020711 500 ng
EUR 329

ID3 Protein Vector (Human) (pPM-C-His)

PV020712 500 ng
EUR 329

ID3 Protein Vector (Mouse) (pPB-C-His)

PV190510 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPB-N-His)

PV190511 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPM-C-HA)

PV190512 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPM-C-His)

PV190513 500 ng
EUR 603

Id3 3'UTR Luciferase Stable Cell Line

TU206079 1.0 ml Ask for price

Id3 3'UTR GFP Stable Cell Line

TU159876 1.0 ml Ask for price

ID3 3'UTR Luciferase Stable Cell Line

TU010403 1.0 ml
EUR 1394

Id3 3'UTR Luciferase Stable Cell Line

TU109876 1.0 ml Ask for price

ID3 3'UTR GFP Stable Cell Line

TU060403 1.0 ml
EUR 1394

Id3 3'UTR GFP Stable Cell Line

TU256079 1.0 ml Ask for price

ID3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673651 1.0 ug DNA
EUR 514

ID3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673655 1.0 ug DNA
EUR 514

ID3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673656 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ID3 Rabbit Polyclonal Antibody