CelltaGen
셀타젠 Genetic Genotyping

ID3 Rabbit Polyclonal Antibody

ID3 Polyclonal Antibody

ABP58864-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117
  • Applications tips:
Description: A polyclonal antibody for detection of ID3 from Human, Mouse, Rat. This ID3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ID3 protein at amino acid sequence of 68-117

ID3 Polyclonal Antibody

ES11398-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ID3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ID3 Polyclonal Antibody

ES11398-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ID3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ID3 Rabbit pAb

A5375-100ul 100 ul
EUR 308

ID3 Rabbit pAb

A5375-200ul 200 ul
EUR 459

ID3 Rabbit pAb

A5375-20ul 20 ul
EUR 183

ID3 Rabbit pAb

A5375-50ul 50 ul
EUR 223

ID3 Antibody

37640-100ul 100ul
EUR 252

ID3 antibody

38647-100ul 100ul
EUR 252

ID3 antibody

10R-4417 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4418 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4419 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4420 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4421 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4422 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4423 100 ul
EUR 691
Description: Mouse monoclonal ID3 antibody

ID3 antibody

10R-4424 100 ul
EUR 726
Description: Mouse monoclonal ID3 antibody

ID3 Antibody

DF12640 200ul
EUR 304
Description: ID3 Antibody detects endogenous levels of ID3.

ID3 Antibody

DF12520 200ul
EUR 304
Description: ID3 Antibody detects endogenous levels of ID3.

ID3 Antibody

1-CSB-PA576712
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ID3 Antibody

1-CSB-PA01959A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ID3 Antibody

ABF9263 100 ug
EUR 438

Polyclonal ID3 Antibody (C-Terminus)

APR02577G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ID3 (C-Terminus). This antibody is tested and proven to work in the following applications:

Id3/ Rat Id3 ELISA Kit

ELI-08420r 96 Tests
EUR 886

ID3 Conjugated Antibody

C37640 100ul
EUR 397

anti- ID3 antibody

FNab04115 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
  • Uniprot ID: Q02535
  • Gene ID: 3399
  • Research Area: Neuroscience, Metabolism, Developmental bi
  • Show more
Description: Antibody raised against ID3

Anti-ID3 antibody

PAab04115 100 ug
EUR 355

Anti-ID3 antibody

STJ27328 100 µl
EUR 277
Description: The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with other HLH proteins. However, the encoded protein lacks a basic DNA-binding domain and therefore inhibits the DNA binding of any HLH protein with which it interacts.

Anti-ID3 antibody

STJ192556 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ID3

ID3 siRNA

20-abx902601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ID3 siRNA

20-abx920133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ID3 siRNA

20-abx920134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ID3

YF-PA12524 50 ul
EUR 363
Description: Mouse polyclonal to ID3

anti-ID3

YF-PA12525 50 ug
EUR 363
Description: Mouse polyclonal to ID3

anti-ID3

YF-PA23944 50 ul
EUR 334
Description: Mouse polyclonal to ID3

ID3 Antibody, HRP conjugated

1-CSB-PA01959B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ID3 Antibody, FITC conjugated

1-CSB-PA01959C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ID3 Antibody, Biotin conjugated

1-CSB-PA01959D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ID3. Recognizes ID3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ID3 Blocking Peptide

DF12640-BP 1mg
EUR 195

ID3 Blocking Peptide

DF12520-BP 1mg
EUR 195

ID3 cloning plasmid

CSB-CL010969HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 360
  • Sequence: atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtccc
  • Show more
Description: A cloning plasmid for the ID3 gene.

Anti-ID3 (4G1)

YF-MA13639 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Anti-ID3 (3E10)

YF-MA13640 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Anti-ID3 (2H8)

YF-MA13641 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Anti-ID3 (3D3)

YF-MA13642 100 ug
EUR 363
Description: Mouse monoclonal to ID3

Canine ID3 ELISA KIT

ELI-31093d 96 Tests
EUR 928

ID3 ELISA KIT|Human

EF010278 96 Tests
EUR 689

Rat ID3 shRNA Plasmid

20-abx985140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ID3 shRNA Plasmid

20-abx952309
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ID3 shRNA Plasmid

20-abx970960
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ID3 Recombinant Protein (Human)

RP015532 100 ug Ask for price

ID3 Recombinant Protein (Rat)

RP205436 100 ug Ask for price

ID3 Recombinant Protein (Mouse)

RP142880 100 ug Ask for price

Monoclonal ID3 Antibody (monoclonal) (M02), Clone: 3E11

AMM03649G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 3E11. This antibody is applicable in WB and IF, E

Monoclonal ID3 Antibody (monoclonal) (M03), Clone: 2H8

AMM03650G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ID3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 2H8. This antibody is applicable in WB and IF, E

Id3 ORF Vector (Rat) (pORF)

ORF068480 1.0 ug DNA
EUR 506

ID3 ORF Vector (Human) (pORF)

ORF005178 1.0 ug DNA
EUR 95

Id3 ORF Vector (Mouse) (pORF)

ORF047628 1.0 ug DNA
EUR 95

pECMV-Id3-m-FLAG Plasmid

PVT15045 2 ug
EUR 325

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

20-abx004116
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

abx030201-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

abx030201-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

20-abx241670
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

abx234115-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody

20-abx333779
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Id3 sgRNA CRISPR Lentivector set (Rat)

K6825601 3 x 1.0 ug
EUR 339

Id3 sgRNA CRISPR Lentivector set (Mouse)

K4367101 3 x 1.0 ug
EUR 339

ID3 sgRNA CRISPR Lentivector set (Human)

K1012601 3 x 1.0 ug
EUR 339

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (HRP)

20-abx335424
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (FITC)

20-abx335425
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DNA-Binding Protein Inhibitor ID-3 (ID3) Antibody (Biotin)

20-abx335426
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Id3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6825602 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6825603 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6825604 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4367102 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4367103 1.0 ug DNA
EUR 154

Id3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4367104 1.0 ug DNA
EUR 154

ID3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1012602 1.0 ug DNA
EUR 154

ID3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1012603 1.0 ug DNA
EUR 154

ID3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1012604 1.0 ug DNA
EUR 154

ID3 Protein Vector (Human) (pPB-C-His)

PV020709 500 ng
EUR 329

ID3 Protein Vector (Human) (pPB-N-His)

PV020710 500 ng
EUR 329

ID3 Protein Vector (Human) (pPM-C-HA)

PV020711 500 ng
EUR 329

ID3 Protein Vector (Human) (pPM-C-His)

PV020712 500 ng
EUR 329

ID3 Protein Vector (Rat) (pPB-C-His)

PV273918 500 ng
EUR 603

ID3 Protein Vector (Rat) (pPB-N-His)

PV273919 500 ng
EUR 603

ID3 Protein Vector (Rat) (pPM-C-HA)

PV273920 500 ng
EUR 603

ID3 Protein Vector (Rat) (pPM-C-His)

PV273921 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPB-C-His)

PV190510 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPB-N-His)

PV190511 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPM-C-HA)

PV190512 500 ng
EUR 603

ID3 Protein Vector (Mouse) (pPM-C-His)

PV190513 500 ng
EUR 603

Id3 3'UTR Luciferase Stable Cell Line

TU109876 1.0 ml Ask for price

Id3 3'UTR Luciferase Stable Cell Line

TU206079 1.0 ml Ask for price

Id3 3'UTR GFP Stable Cell Line

TU159876 1.0 ml Ask for price

Id3 3'UTR GFP Stable Cell Line

TU256079 1.0 ml Ask for price

ID3 3'UTR GFP Stable Cell Line

TU060403 1.0 ml
EUR 1394

ID3 3'UTR Luciferase Stable Cell Line

TU010403 1.0 ml
EUR 1394

ID3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673651 1.0 ug DNA
EUR 514

ID3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673655 1.0 ug DNA
EUR 514

ID3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673656 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

ID3 Rabbit Polyclonal Antibody