IRGM Rabbit Polyclonal Antibody
 IRGM Polyclonal Antibody |
|
ABP58965-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IRGM from Human. This IRGM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150 |
IRGM Polyclonal Antibody |
|
ABP58965-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IRGM from Human. This IRGM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150 |
IRGM Polyclonal Antibody |
|
ABP58965-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150
- Applications tips:
|
|
Description: A polyclonal antibody for detection of IRGM from Human. This IRGM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRGM protein at amino acid sequence of 101-150 |
IRGM Polyclonal Antibody |
|
ES11414-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IRGM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IRGM Polyclonal Antibody |
|
ES11414-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IRGM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 Polyclonal Antibody) Rabbit Anti Irgm (Internal Region) Polyclonal Antibody |
|
CPBT-66123RI |
Creative Diagnostics |
50 µg |
EUR 533 |
Rabbit Anti Irgm (Internal Region) Polyclonal Antibody |
|
CPBT-66124RI |
Creative Diagnostics |
0.1 mg |
EUR 663 |
 IRGM Rabbit pAb |
|
A10968-100ul |
Abclonal |
100 ul |
EUR 308 |
IRGM Rabbit pAb |
|
A10968-200ul |
Abclonal |
200 ul |
EUR 459 |
IRGM Rabbit pAb |
|
A10968-20ul |
Abclonal |
20 ul |
Ask for price |
IRGM Rabbit pAb |
|
A10968-50ul |
Abclonal |
50 ul |
Ask for price |
 IRGM Antibody |
|
24660-100ul |
SAB |
100ul |
EUR 390 |
IRGM Antibody |
|
24661-100ul |
SAB |
100ul |
EUR 390 |
IRGM Antibody |
|
36558-100ul |
SAB |
100ul |
EUR 252 |
IRGM Antibody |
|
1-CSB-PA071110 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against IRGM. Recognizes IRGM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
IRGM Antibody |
|
1-CSB-PA117915 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against IRGM. Recognizes IRGM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
IRGM Antibody |
|
1-CSB-PA011827ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against IRGM. Recognizes IRGM from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
) Polyclonal IRGM Antibody (C-term) |
|
APR08031G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRGM (C-term). This antibody is tested and proven to work in the following applications: |
) Polyclonal IRGM / LRG-47 Antibody (Internal) |
|
APR08028G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRGM / LRG-47 (Internal). This antibody is tested and proven to work in the following applications: |
 Human IRGM Antibody |
|
33388-05111 |
AssayPro |
150 ug |
EUR 261 |
 IRGM Conjugated Antibody |
|
C36558 |
SAB |
100ul |
EUR 397 |
 Anti-IRGM antibody |
|
STJ112856 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-IRGM antibody |
|
STJ192572 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to IRGM |
 IRGM siRNA |
|
20-abx920817 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IRGM siRNA |
|
20-abx920818 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody for Human IRGM |
|
SPC-681D |
Stressmarq |
0.1mg |
EUR 354 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is unconjugated. |
Antibody for Human IRGM |
|
SPC-681D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 390. |
Antibody for Human IRGM |
|
SPC-681D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 488. |
Antibody for Human IRGM |
|
SPC-681D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 565. |
Antibody for Human IRGM |
|
SPC-681D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 594. |
Antibody for Human IRGM |
|
SPC-681D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 633. |
Antibody for Human IRGM |
|
SPC-681D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 655. |
Antibody for Human IRGM |
|
SPC-681D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 680. |
Antibody for Human IRGM |
|
SPC-681D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to ATTO 700. |
Antibody for Human IRGM |
|
SPC-681D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human IRGM |
|
SPC-681D-APC |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to APC . |
Antibody for Human IRGM |
|
SPC-681D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to APC/Cy7. |
Antibody for Human IRGM |
|
SPC-681D-BI |
Stressmarq |
0.1mg |
EUR 396 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Biotin. |
Antibody for Human IRGM |
|
SPC-681D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 350. |
Antibody for Human IRGM |
|
SPC-681D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 405. |
Antibody for Human IRGM |
|
SPC-681D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 488. |
Antibody for Human IRGM |
|
SPC-681D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 594. |
Antibody for Human IRGM |
|
SPC-681D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Dylight 633. |
Antibody for Human IRGM |
|
SPC-681D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to FITC. |
Antibody for Human IRGM |
|
SPC-681D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to HRP. |
Antibody for Human IRGM |
|
SPC-681D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to PE/ATTO 594. |
Antibody for Human IRGM |
|
SPC-681D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to PerCP. |
Antibody for Human IRGM |
|
SPC-681D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to RPE . |
Antibody for Human IRGM |
|
SPC-681D-STR |
Stressmarq |
0.1mg |
EUR 398 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is conjugated to Streptavidin. |
Antibody for Human IRGM |
|
SPC-681S |
Stressmarq |
0.012mg |
EUR 65 |
|
Description: A polyclonal antibody for IRGM from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human IRGM. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This IRGM antibody is unconjugated. |
 IRGM cloning plasmid |
|
CSB-CL011827HU-10ug |
Cusabio |
10ug |
EUR 259 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 537
- Sequence: ATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGC
- Show more
|
|
Description: A cloning plasmid for the IRGM gene. |
) Human IRGM Antibody (Biotin Conjugate) |
|
33388-05121 |
AssayPro |
150 ug |
EUR 369 |
) IRGM protein (His tag) |
|
80R-2611 |
Fitzgerald |
100 ug |
EUR 322 |
|
Description: Purified recombinant IRGM protein |
 Rat IRGM shRNA Plasmid |
|
20-abx989174 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human IRGM shRNA Plasmid |
|
20-abx967469 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) IRGM Recombinant Protein (Human) |
|
RP040150 |
ABM |
100 ug |
Ask for price |
) IRGM Recombinant Protein (Rat) |
|
RP206258 |
ABM |
100 ug |
Ask for price |
) Human IRGM AssayLite Antibody (FITC Conjugate) |
|
33388-05141 |
AssayPro |
150 ug |
EUR 428 |
) Human IRGM AssayLite Antibody (RPE Conjugate) |
|
33388-05151 |
AssayPro |
150 ug |
EUR 428 |
) Human IRGM AssayLite Antibody (APC Conjugate) |
|
33388-05161 |
AssayPro |
150 ug |
EUR 428 |
) Human IRGM AssayLite Antibody (PerCP Conjugate) |
|
33388-05171 |
AssayPro |
150 ug |
EUR 471 |
 Antibody) Immunity Related GTPase M (IRGM) Antibody |
|
abx412110-01mg |
Abbexa |
0.1 mg |
EUR 537 |
|
|
 (pORF)) Irgm ORF Vector (Rat) (pORF) |
|
ORF068754 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) IRGM ORF Vector (Human) (pORF) |
|
ORF013384 |
ABM |
1.0 ug DNA |
EUR 354 |
 Antibody) Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
abx026104-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
abx026104-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
20-abx210849 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
20-abx126951 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
20-abx339551 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
20-abx321743 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Immunity-Related GTPase Family M Protein (IRGM) Antibody |
|
abx448534-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
) Irgm sgRNA CRISPR Lentivector set (Rat) |
|
K6649901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) IRGM sgRNA CRISPR Lentivector set (Human) |
|
K1099401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody (ALP)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ALP) |
|
abx448005-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (APC)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (APC) |
|
abx448006-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Biotin)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (Biotin) |
|
abx448007-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (FITC)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (FITC) |
|
abx448008-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (HRP)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (HRP) |
|
abx448009-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
 Antibody (PerCP)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (PerCP) |
|
abx448011-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (RPE)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (RPE) |
|
abx448012-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (Streptavidin)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (Streptavidin) |
|
abx448013-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 (Target 1)) Irgm sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6649902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Irgm sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6649903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Irgm sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6649904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) IRGM sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1099402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) IRGM sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1099403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) IRGM sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1099404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) IRGM Protein Vector (Rat) (pPB-C-His) |
|
PV275014 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) IRGM Protein Vector (Rat) (pPB-N-His) |
|
PV275015 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) IRGM Protein Vector (Rat) (pPM-C-HA) |
|
PV275016 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) IRGM Protein Vector (Rat) (pPM-C-His) |
|
PV275017 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) IRGM Protein Vector (Human) (pPB-C-His) |
|
PV053533 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) IRGM Protein Vector (Human) (pPB-N-His) |
|
PV053534 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) IRGM Protein Vector (Human) (pPM-C-HA) |
|
PV053535 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) IRGM Protein Vector (Human) (pPM-C-His) |
|
PV053536 |
ABM |
500 ng |
EUR 481 |
 Irgm 3'UTR Luciferase Stable Cell Line |
|
TU206381 |
ABM |
1.0 ml |
Ask for price |
 Irgm 3'UTR GFP Stable Cell Line |
|
TU256381 |
ABM |
1.0 ml |
Ask for price |
 IRGM 3'UTR GFP Stable Cell Line |
|
TU061269 |
ABM |
1.0 ml |
EUR 1394 |
 IRGM 3'UTR Luciferase Stable Cell Line |
|
TU011269 |
ABM |
1.0 ml |
EUR 1394 |
 Antibody (ATTO 390)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 390) |
|
abx447997-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 488)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 488) |
|
abx447998-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 565)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 565) |
|
abx447999-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 594)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 594) |
|
abx448000-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 633)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 633) |
|
abx448001-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 655)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 655) |
|
abx448002-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 680)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 680) |
|
abx448003-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
 Antibody (ATTO 700)) Immunity-Related GTPase Family M Protein (IRGM) Antibody (ATTO 700) |
|
abx448004-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
) Human Immunity-related GTPase family M protein (IRGM) |
|
1-CSB-EP011827HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 47.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Immunity-related GTPase family M protein(IRGM) expressed in E.coli |
 Protein) Immunity-Related GTPase Family M Protein (IRGM) Protein |
|
20-abx260986 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 (CMV) (pLenti-GIII-CMV)) IRGM Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV682207 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) IRGM Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV682211 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) IRGM Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV682212 |
ABM |
1.0 ug DNA |
EUR 682 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
IRGM Rabbit Polyclonal Antibody
 Polyclonal Antibody)
