CelltaGen
셀타젠 Genetic Genotyping

ISG15 Rabbit Polyclonal Antibody

ISG15 Polyclonal Antibody

ES11018-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ISG15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ISG15 Rabbit pAb

A1182-100ul 100 ul
EUR 308

ISG15 Rabbit pAb

A1182-200ul 200 ul
EUR 459

ISG15 Rabbit pAb

A1182-20ul 20 ul
EUR 183

ISG15 Rabbit pAb

A1182-50ul 50 ul
EUR 223

ISG15 Rabbit pAb

A0154-100ul 100 ul
EUR 308

ISG15 Rabbit pAb

A0154-200ul 200 ul
EUR 459

ISG15 Rabbit pAb

A0154-20ul 20 ul Ask for price

ISG15 Rabbit pAb

A0154-50ul 50 ul Ask for price

ISG15 Rabbit mAb

A2416-100ul 100 ul
EUR 410

ISG15 Rabbit mAb

A2416-200ul 200 ul
EUR 571

ISG15 Rabbit mAb

A2416-20ul 20 ul
EUR 221

ISG15 Rabbit mAb

A2416-50ul 50 ul
EUR 287

Rabbit Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E04U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E04U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E04U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Polyclonal ISG15 Antibody (N-term)

APR03570G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ISG15 (N-term). This antibody is tested and proven to work in the following applications:

ISG15 Polyclonal Antibody, Biotin Conjugated

A53053 100 µg
EUR 570.55
Description: fast delivery possible

ISG15 Polyclonal Antibody, FITC Conjugated

A53054 100 µg
EUR 570.55
Description: reagents widely cited

ISG15 Polyclonal Antibody, HRP Conjugated

A53055 100 µg
EUR 570.55
Description: Ask the seller for details

ISG15 antibody

70R-18015 50 ul
EUR 435
Description: Rabbit polyclonal ISG15 antibody

ISG15 antibody

70R-15378 100 ug
EUR 327
Description: Rabbit polyclonal ISG15 antibody

ISG15 antibody

38211-100ul 100ul
EUR 252

ISG15 antibody

10R-1044 100 ul
EUR 316
Description: Mouse monoclonal ISG15 antibody

ISG15 Antibody

1-CSB-PA09744A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IP; Recommended dilution: WB:1:1000-1:5000, IP:1:200-1:2000

ISG15 Antibody

DF6316 200ul
EUR 304
Description: ISG15 Antibody detects endogenous levels of total ISG15.

ISG15 antibody

70R-9759 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ISG15 antibody

ISG15 Antibody

1-CSB-PA011843GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ISG15 Antibody

ABD6316 100 ug
EUR 438

Ubiquitin-Like Protein ISG15 (ISG15) Antibody

abx026299-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin-Like Protein ISG15 (ISG15) Antibody

abx026299-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ubiquitin-Like Modifier ISG15 (ISG15) Antibody

20-abx110334
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Like Modifier ISG15 (ISG15) Antibody

20-abx113276
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Like Protein ISG15 (ISG15) Antibody

abx234403-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Ubiquitin-Like Protein ISG15 (ISG15) Antibody

20-abx225253
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-Like Protein ISG15 (ISG15) Antibody

20-abx000576
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ubiquitin-Like Protein ISG15 (ISG15) Antibody

20-abx001096
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin-like protein ISG15 Polyclonal Antibody

42509-100ul 100ul
EUR 333

Ubiquitin-Like Modifier ISG15 (ISG15) Antibody (Biotin)

20-abx106053
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Like Modifier ISG15 (ISG15) Antibody (FITC)

20-abx107467
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Like Modifier ISG15 (ISG15) Antibody (HRP)

20-abx108886
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin-Like Protein ISG15 (ISG15) Antibody Pair

abx117387-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Human ISG15 Antibody

32691-05111 150 ug
EUR 261

ISG15 antibody (HRP)

60R-1951 100 ug
EUR 327
Description: Rabbit polyclonal ISG15 antibody (HRP)

ISG15 antibody (FITC)

60R-1952 100 ug
EUR 327
Description: Rabbit polyclonal ISG15 antibody (FITC)

ISG15 antibody (biotin)

60R-1953 100 ug
EUR 327
Description: Rabbit polyclonal ISG15 antibody (biotin)

ISG15 Conjugated Antibody

C38211 100ul
EUR 397

anti- ISG15 antibody

FNab04403 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: :1:50 - 1:200
  • Immunogen: ISG15 ubiquitin-like modifier
  • Uniprot ID: P05161
  • Gene ID: 9636
  • Research Area: Epigenetics, Immunology, Signal Transduction, Metabolism
Description: Antibody raised against ISG15

Anti-ISG15 antibody

PAab04403 100 ug
EUR 412

Anti-ISG15 Antibody

PB9950 100ug/vial
EUR 334

Anti-ISG15 Antibody

PB9951 100ug/vial
EUR 334

Anti-ISG15 antibody

STJ24237 100 µl
EUR 277
Description: The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted.

Anti-ISG15 antibody

STJ24238 100 µl
EUR 277
Description: The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted.

Anti-ISG15 antibody

STJ192176 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ISG15

Ubiquitin-like protein ISG15 Polyclonal Conjugated Antibody

C42509 100ul
EUR 397

Human Ubiquitin-like protein ISG15 (Isg15)

1-CSB-RP097444h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-like protein ISG15(Isg15) expressed in E.coli

Human Ubiquitin-like protein ISG15 (Isg15)

1-CSB-RP097474h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ubiquitin-like protein ISG15(Isg15) expressed in E.coli

ISG15 siRNA

20-abx920845
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ISG15 siRNA

20-abx920846
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ISG15

YF-PA16447 100 ul
EUR 403
Description: Rabbit polyclonal to ISG15

anti-ISG15

YF-PA16448 100 ug
EUR 403
Description: Rabbit polyclonal to ISG15

ISG15 Antibody, HRP conjugated

1-CSB-PA09744B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ISG15 Antibody, FITC conjugated

1-CSB-PA09744C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ISG15 Antibody, Biotin conjugated

1-CSB-PA09744D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ISG15 recombinant monoclonal antibody

A5576 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human ISG15 for WB, IHC,ELISA

Anti-ISG15 Monoclonal Antibody

M00554 100ug
EUR 397
Description: Rabbit Monoclonal ISG15 Antibody. Validated in IF, WB and tested in Human.

Bovine ISG15/ Ubiquitin-like protein ISG15 ELISA Kit

E0160Bo 1 Kit
EUR 717

Rat Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E02U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E02U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E02U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E01U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E01U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E01U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E03U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E03U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E03U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E07U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E07U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E07U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E08U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E08U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E08U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E09U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E09U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E09U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E06U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E06U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E06U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Isg15/ Ubiquitin-like protein ISG15 ELISA Kit

E0809Mo 1 Kit
EUR 632

Human ISG15/ Ubiquitin-like protein ISG15 ELISA Kit

E1338Hu 1 Kit
EUR 605

Human ISG15(Ubiquitin-like protein ISG15) ELISA Kit

EH1673 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P05161
  • Alias: ISG15(Interferon Stimulated Gene 15)/UCRP/G1P2/IFI15/IP17/G1P2interferon-induced 17-kDa/15-kDa protein/interferon, alpha-inducible protein(clone IFI-15K)/Interferon-induced 15 kDa protein/In
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Ubiquitin- like protein ISG15, ISG15 ELISA KIT

ELI-13094h 96 Tests
EUR 824

Bovine Ubiquitin- like protein ISG15, ISG15 ELISA KIT

ELI-28057b 96 Tests
EUR 928

Mouse Ubiquitin- like protein ISG15, Isg15 ELISA KIT

ELI-43443m 96 Tests
EUR 865

Bovine Ubiquitin-like protein ISG15(ISG15) ELISA kit

CSB-EL011843BO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Ubiquitin-like protein ISG15 (ISG15) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine Ubiquitin-like protein ISG15(ISG15) ELISA kit

1-CSB-EL011843BO
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Ubiquitin-like protein ISG15(ISG15) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Ubiquitin-like protein ISG15(ISG15) ELISA kit

CSB-EL011843MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Ubiquitin-like protein ISG15(ISG15) ELISA kit

1-CSB-EL011843MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Ubiquitin-like protein ISG15(ISG15) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Ubiquitin-Like Protein ISG15 (ISG15) ELISA Kit

abx517209-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Ubiquitin-like protein ISG15 (ISG15) ELISA Kit

abx517210-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA Kit

abx517211-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

ISG15 Blocking Peptide

33R-2638 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ISG15 antibody, catalog no. 70R-9759

ISG15 Blocking Peptide

DF6316-BP 1mg
EUR 195

ISG15 cloning plasmid

CSB-CL011843HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 498
  • Sequence: atgggctgggacctgacggtgaagatgctggcgggcaacgaattccaggtgtccctgagcagctccatgtcggtgtcagagctgaaggcgcagatcacccagaagatcggcgtgcacgccttccagcagcgtctggctgtccacccgagcggtgtggcgctgcaggacagggtccc
  • Show more
Description: A cloning plasmid for the ISG15 gene.

Human ISG15 Antibody (Biotin Conjugate)

32691-05121 150 ug
EUR 369

Guinea pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E05U0075-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E05U0075-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit

E05U0075-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Ubiquitin-Like Protein ISG15/ISG15 (C-6His)

CG40-10ug 10ug
EUR 95
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES, 100mM NaCl, pH 8.0.

Recombinant Human Ubiquitin-Like Protein ISG15/ISG15 (C-6His)

CG40-1mg 1mg
EUR 1674
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES, 100mM NaCl, pH 8.0.

ISG15 Rabbit Polyclonal Antibody