ISG15 Rabbit Polyclonal Antibody
ISG15 Polyclonal Antibody |
A53056 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ISG15 Rabbit pAb |
A0154-100ul |
Abclonal |
100 ul |
EUR 308 |
ISG15 Rabbit pAb |
A0154-200ul |
Abclonal |
200 ul |
EUR 459 |
ISG15 Rabbit pAb |
A0154-20ul |
Abclonal |
20 ul |
Ask for price |
ISG15 Rabbit pAb |
A0154-50ul |
Abclonal |
50 ul |
Ask for price |
ISG15 Rabbit pAb |
A1182-100ul |
Abclonal |
100 ul |
EUR 308 |
ISG15 Rabbit pAb |
A1182-200ul |
Abclonal |
200 ul |
EUR 459 |
ISG15 Rabbit pAb |
A1182-20ul |
Abclonal |
20 ul |
EUR 183 |
ISG15 Rabbit pAb |
A1182-50ul |
Abclonal |
50 ul |
EUR 223 |
ISG15 Rabbit mAb |
A2416-100ul |
Abclonal |
100 ul |
EUR 410 |
ISG15 Rabbit mAb |
A2416-200ul |
Abclonal |
200 ul |
EUR 571 |
ISG15 Rabbit mAb |
A2416-20ul |
Abclonal |
20 ul |
EUR 221 |
ISG15 Rabbit mAb |
A2416-50ul |
Abclonal |
50 ul |
EUR 287 |
Rabbit Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E04U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E04U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E04U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Polyclonal ISG15 Antibody (N-term) |
APR03570G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ISG15 (N-term). This antibody is tested and proven to work in the following applications: |
ISG15 Polyclonal Antibody, Biotin Conjugated |
A53053 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ISG15 Polyclonal Antibody, FITC Conjugated |
A53054 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ISG15 Polyclonal Antibody, HRP Conjugated |
A53055 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ISG15 antibody |
70R-9759 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ISG15 antibody |
ISG15 antibody |
38211-100ul |
SAB |
100ul |
EUR 252 |
ISG15 antibody |
10R-1044 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal ISG15 antibody |
ISG15 antibody |
70R-18015 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ISG15 antibody |
ISG15 antibody |
70R-15378 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ISG15 antibody |
ISG15 Antibody |
DF6316 |
Affbiotech |
200ul |
EUR 304 |
Description: ISG15 Antibody detects endogenous levels of total ISG15. |
ISG15 Antibody |
1-CSB-PA011843GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
ISG15 Antibody |
1-CSB-PA09744A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IP; Recommended dilution: WB:1:1000-1:5000, IP:1:200-1:2000 |
Ubiquitin-Like Modifier ISG15 (ISG15) Antibody |
20-abx113276 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like Modifier ISG15 (ISG15) Antibody |
20-abx110334 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like Protein ISG15 (ISG15) Antibody |
20-abx000576 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like Protein ISG15 (ISG15) Antibody |
20-abx001096 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like Protein ISG15 (ISG15) Antibody |
abx026299-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Ubiquitin-Like Protein ISG15 (ISG15) Antibody |
abx026299-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Ubiquitin-Like Protein ISG15 (ISG15) Antibody |
abx234403-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Ubiquitin-Like Protein ISG15 (ISG15) Antibody |
20-abx225253 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Ubiquitin-like protein ISG15 Polyclonal Antibody |
42509-100ul |
SAB |
100ul |
EUR 333 |
Ubiquitin-Like Protein ISG15 (ISG15) Antibody Pair |
abx117387-1pair5x96wellplates |
Abbexa |
1 pair (5x96 well plates) |
EUR 1010 |
- Shipped within 5-10 working days.
|
Ubiquitin-Like Modifier ISG15 (ISG15) Antibody (HRP) |
20-abx108886 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like Modifier ISG15 (ISG15) Antibody (Biotin) |
20-abx106053 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ubiquitin-Like Modifier ISG15 (ISG15) Antibody (FITC) |
20-abx107467 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ISG15 Conjugated Antibody |
C38211 |
SAB |
100ul |
EUR 397 |
anti- ISG15 antibody |
FNab04403 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: :1:50 - 1:200
- Immunogen: ISG15 ubiquitin-like modifier
- Uniprot ID: P05161
- Gene ID: 9636
- Research Area: Epigenetics, Immunology, Signal Transduction, Metabolism
|
Description: Antibody raised against ISG15 |
Human ISG15 Antibody |
32691-05111 |
AssayPro |
150 ug |
EUR 261 |
ISG15 antibody (HRP) |
60R-1951 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ISG15 antibody (HRP) |
ISG15 antibody (FITC) |
60R-1952 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ISG15 antibody (FITC) |
ISG15 antibody (biotin) |
60R-1953 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal ISG15 antibody (biotin) |
Anti-ISG15 Antibody |
PB9950 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-ISG15 Antibody |
PB9951 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-ISG15 antibody |
STJ24237 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. |
Anti-ISG15 antibody |
STJ24238 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. |
Anti-ISG15 antibody |
STJ192176 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ISG15 |
Ubiquitin-like protein ISG15 Polyclonal Conjugated Antibody |
C42509 |
SAB |
100ul |
EUR 397 |
Human Ubiquitin-like protein ISG15 (Isg15) |
1-CSB-RP097444h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 44.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Ubiquitin-like protein ISG15(Isg15) expressed in E.coli |
Human Ubiquitin-like protein ISG15 (Isg15) |
1-CSB-RP097474h |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 21.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Ubiquitin-like protein ISG15(Isg15) expressed in E.coli |
ISG15 siRNA |
20-abx920845 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ISG15 siRNA |
20-abx920846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ISG15 |
YF-PA16447 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to ISG15 |
anti-ISG15 |
YF-PA16448 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to ISG15 |
ISG15 recombinant monoclonal antibody |
A5576 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human ISG15 for WB, IHC,ELISA |
ISG15 Antibody, HRP conjugated |
1-CSB-PA09744B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ISG15 Antibody, FITC conjugated |
1-CSB-PA09744C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ISG15 Antibody, Biotin conjugated |
1-CSB-PA09744D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ISG15. Recognizes ISG15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-ISG15 Monoclonal Antibody |
M00554 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal ISG15 Antibody. Validated in IF, WB and tested in Human. |
Cow Ubiquitin-Like Protein ISG15 (ISG15) ELISA Kit |
abx517209-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Ubiquitin-like protein ISG15 (ISG15) ELISA Kit |
abx517210-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA Kit |
abx517211-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E03U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E03U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E03U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E01U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E01U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E01U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E02U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E02U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E02U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Isg15/ Ubiquitin-like protein ISG15 ELISA Kit |
E0809Mo |
Sunlong |
1 Kit |
EUR 632 |
Dog Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E08U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E08U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E08U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E07U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E07U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E07U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E06U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E06U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E06U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ISG15/ Ubiquitin-like protein ISG15 ELISA Kit |
E1338Hu |
Sunlong |
1 Kit |
EUR 605 |
Monkey Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E09U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E09U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E09U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ISG15(Ubiquitin-like protein ISG15) ELISA Kit |
EH1673 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P05161
- Alias: ISG15(Interferon Stimulated Gene 15)/UCRP/G1P2/IFI15/IP17/G1P2interferon-induced 17-kDa/15-kDa protein/interferon, alpha-inducible protein(clone IFI-15K)/Interferon-induced 15 kDa protein/In
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Ubiquitin- like protein ISG15, ISG15 ELISA KIT |
ELI-13094h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Ubiquitin- like protein ISG15, ISG15 ELISA KIT |
ELI-28057b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Ubiquitin- like protein ISG15, Isg15 ELISA KIT |
ELI-43443m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Ubiquitin-like protein ISG15(ISG15) ELISA kit |
CSB-EL011843BO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Bovine Ubiquitin-like protein ISG15 (ISG15) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Bovine Ubiquitin-like protein ISG15(ISG15) ELISA kit |
1-CSB-EL011843BO |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Bovine Ubiquitin-like protein ISG15(ISG15) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Ubiquitin-like protein ISG15(ISG15) ELISA kit |
CSB-EL011843MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Ubiquitin-like protein ISG15 (ISG15) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Ubiquitin-like protein ISG15(ISG15) ELISA kit |
1-CSB-EL011843MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Ubiquitin-like protein ISG15(ISG15) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Bovine ISG15/ Ubiquitin-like protein ISG15 ELISA Kit |
E0160Bo |
Sunlong |
1 Kit |
EUR 717 |
ISG15 cloning plasmid |
CSB-CL011843HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 498
- Sequence: atgggctgggacctgacggtgaagatgctggcgggcaacgaattccaggtgtccctgagcagctccatgtcggtgtcagagctgaaggcgcagatcacccagaagatcggcgtgcacgccttccagcagcgtctggctgtccacccgagcggtgtggcgctgcaggacagggtccc
- Show more
|
Description: A cloning plasmid for the ISG15 gene. |
ISG15 Blocking Peptide |
33R-2638 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ISG15 antibody, catalog no. 70R-9759 |
ISG15 Blocking Peptide |
DF6316-BP |
Affbiotech |
1mg |
EUR 195 |
Human ISG15 Antibody (Biotin Conjugate) |
32691-05121 |
AssayPro |
150 ug |
EUR 369 |
Guinea pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E05U0075-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E05U0075-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Ubiquitin-like protein ISG15 (ISG15) ELISA kit |
E05U0075-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ubiquitin-like protein ISG15 (ISG15) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Recombinant Human Ubiquitin-Like Protein ISG15/ISG15 (C-6His) |
CG40-10ug |
Novoprotein |
10ug |
EUR 95 |
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES, 100mM NaCl, pH 8.0. |
Recombinant Human Ubiquitin-Like Protein ISG15/ISG15 (C-6His) |
CG40-1mg |
Novoprotein |
1mg |
EUR 1674 |
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES, 100mM NaCl, pH 8.0. |
ISG15 Rabbit Polyclonal Antibody