
셀타젠 Genetic Genotyping

KLK13 Rabbit Polyclonal Antibody

KLK13 Rabbit Polyclonal Antibody

Human Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Hu-48T 48T
EUR 517
  • Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Hu-96T 96T
EUR 673
  • Should the Human Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Mu-48T 48T
EUR 527
  • Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

DLR-KLK13-Mu-96T 96T
EUR 688
  • Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Hu-48Tests 48 Tests
EUR 544

Human Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Hu-96Tests 96 Tests
EUR 756

Mouse Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Mu-48Tests 48 Tests
EUR 557

Mouse Kallikrein 13 (KLK13) ELISA Kit

RDR-KLK13-Mu-96Tests 96 Tests
EUR 774

Human Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Hu-48Tests 48 Tests
EUR 521

Human Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Hu-96Tests 96 Tests
EUR 723

Mouse Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Mu-48Tests 48 Tests
EUR 533

Mouse Kallikrein 13 (KLK13) ELISA Kit

RD-KLK13-Mu-96Tests 96 Tests
EUR 740

KLK13 Rabbit pAb

A14274-100ul 100 ul
EUR 308

KLK13 Rabbit pAb

A14274-200ul 200 ul
EUR 459

KLK13 Rabbit pAb

A14274-20ul 20 ul
EUR 183

KLK13 Rabbit pAb

A14274-50ul 50 ul
EUR 223

KLK13 Antibody

36578-100ul 100ul
EUR 252

KLK13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KLK13 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

KLK13 antibody

70R-3265 50 ug
EUR 467
Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13

Kallikrein 13 (KLK13) polyclonal antibody

ABP-PAB-10239 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

Kallikrein 13 (KLK13) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13)

KLK13 Conjugated Antibody

C36578 100ul
EUR 397

Anti-KLK13 antibody

STJ116486 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined.

Anti-KLK13 antibody

STJ192250 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK13

Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277)

APR02667G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications:

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE.

KLK13 protein

80R-4293 20 ug
EUR 327
Description: Purified Recombinant KLK13 protein (His tagged)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Kallikrein 13 (KLK13) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 13 (KLK13) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 13 (KLK13) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 13 (KLK13) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Glu22~Gln277)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13)

KLK13 Blocking Peptide

33R-9689 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265

KLK13 cloning plasmid

CSB-CL891952HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 834
  • Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct
  • Show more
Description: A cloning plasmid for the KLK13 gene.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE.

KLK13 protein (His tag)

80R-4083 10 ug
EUR 327
Description: Recombinant Human KLK13 protein (His tag)

Human KLK13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Kallikrein 13 (KLK13)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKR3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: E.coli

Recombinant Kallikrein 13 (KLK13)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P36368
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli

KLK13 Recombinant Protein (Human)

RP017230 100 ug Ask for price

KLK13 Recombinant Protein (Rat)

RP207395 100 ug Ask for price

KLK13 Recombinant Protein (Mouse)

RP146090 100 ug Ask for price

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK13 (Val25~Ala261)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

Human Kallikrein 13 (KLK13) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Kallikrein 13 (KLK13) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human KLK13

EK5504 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KLK13 PicoKine ELISA Kit

EK1168 96 wells
EUR 425
Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

OVA conjugated Kallikrein 13 (KLK13)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UKR3
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis

Klk13 ORF Vector (Rat) (pORF)

ORF069133 1.0 ug DNA
EUR 506

KLK13 ORF Vector (Human) (pORF)

ORF005744 1.0 ug DNA
EUR 95

Klk13 ORF Vector (Mouse) (pORF)

ORF048698 1.0 ug DNA
EUR 506

KLK13 ELISA Kit (Human) (OKCD00765)

OKCD00765 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.6 pg/mL

KLK13 ELISA Kit (Human) (OKBB00909)

OKBB00909 96 Wells
EUR 505
Description: Description of target: Kallikrein-13 is a protein that in humans is encoded by the KLK13 gene. It belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. By genomic sequence analysis, KLK13 gene is mapped in a 300-kb region on chromosome 19q13.3-q13.4. It has been shown that recombinant hK13 produced in yeast can cleave synthetic peptides after the arginine residue and some extracellular matrix components. However, its exact physiological substrates and functions remain obscure. Despite the lack of knowledge on the physiological function of hK13, several studies have demonstrated that hK13 is implicated with cancer of the breast and ovary and it can serve as a favorable prognostic biomarker for these malignancies.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Mouse Kallikrein 13 (KLK13) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein 13 (KLK13) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Kallikrein- 13, KLK13 ELISA KIT

ELI-43303h 96 Tests
EUR 824

Human Kallikrein 13 (KLK13) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Kallikrein 13 (KLK13) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Klk13 sgRNA CRISPR Lentivector set (Rat)

K6739401 3 x 1.0 ug
EUR 339

Klk13 sgRNA CRISPR Lentivector set (Mouse)

K4322401 3 x 1.0 ug
EUR 339

KLK13 sgRNA CRISPR Lentivector set (Human)

K1160701 3 x 1.0 ug
EUR 339

KLK13 Kallikrein-13 Human Recombinant Protein

PROTQ9UKR3 Regular: 5ug
EUR 317
Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Kallikrein 13(KLK13)ELISA Kit

QY-E02952 96T
EUR 361

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

SED373Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
  • KLKL4
  • Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

SED373Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
  • KLKL4
  • Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human KLK13 (Kallikrein 13)

ELK4917 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)

C362-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

ELISA kit for Mouse KLK13 (Kallikrein 13)

ELK7224 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Klk13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6739402 1.0 ug DNA
EUR 154

Klk13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6739403 1.0 ug DNA
EUR 154

Klk13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6739404 1.0 ug DNA
EUR 154

Klk13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4322402 1.0 ug DNA
EUR 154

Klk13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4322403 1.0 ug DNA
EUR 154

Klk13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4322404 1.0 ug DNA
EUR 154

KLK13 sgRNA CRISPR Lentivector (Human) (Target 1)

K1160702 1.0 ug DNA
EUR 154

KLK13 sgRNA CRISPR Lentivector (Human) (Target 2)

K1160703 1.0 ug DNA
EUR 154

KLK13 sgRNA CRISPR Lentivector (Human) (Target 3)

K1160704 1.0 ug DNA
EUR 154

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-48T 48T
EUR 332
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)

KTE61899-96T 96T
EUR 539
  • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

KLK13 Protein Vector (Human) (pPB-C-His)

PV022973 500 ng
EUR 329

KLK13 Protein Vector (Human) (pPB-N-His)

PV022974 500 ng
EUR 329

KLK13 Protein Vector (Human) (pPM-C-HA)

PV022975 500 ng
EUR 329

KLK13 Protein Vector (Human) (pPM-C-His)

PV022976 500 ng
EUR 329

KLK13 Protein Vector (Rat) (pPB-C-His)

PV276530 500 ng
EUR 603

KLK13 Protein Vector (Rat) (pPB-N-His)

PV276531 500 ng
EUR 603

KLK13 Protein Vector (Rat) (pPM-C-HA)

PV276532 500 ng
EUR 603

KLK13 Protein Vector (Rat) (pPM-C-His)

PV276533 500 ng
EUR 603

KLK13 Protein Vector (Mouse) (pPB-C-His)

PV194790 500 ng
EUR 603

KLK13 Protein Vector (Mouse) (pPB-N-His)

PV194791 500 ng
EUR 603

KLK13 Protein Vector (Mouse) (pPM-C-HA)

PV194792 500 ng
EUR 603

KLK13 Protein Vector (Mouse) (pPM-C-His)

PV194793 500 ng
EUR 603

Recombinant Human KLK13 Protein, His, E.coli-1ug

QP12503-1ug 1ug
EUR 155

Recombinant Human KLK13 Protein, His, E.coli-50ug

QP12503-50ug 50ug
EUR 1261

Recombinant Human KLK13 Protein, His, E.coli-5ug

QP12503-5ug 5ug
EUR 201

Recombinant Human KLK13 Protein, His, Insect-1ug

QP10737-1ug 1ug
EUR 155

Recombinant Human KLK13 Protein, His, Insect-50ug

QP10737-50ug 50ug
EUR 1261

Recombinant Human KLK13 Protein, His, Insect-5ug

QP10737-5ug 5ug
EUR 201

Klk13 3'UTR Luciferase Stable Cell Line

TU110666 1.0 ml Ask for price

Klk13 3'UTR GFP Stable Cell Line

TU160666 1.0 ml Ask for price

Klk13 3'UTR Luciferase Stable Cell Line

TU206788 1.0 ml Ask for price

Klk13 3'UTR GFP Stable Cell Line

TU256788 1.0 ml Ask for price

KLK13 3'UTR GFP Stable Cell Line

TU061899 1.0 ml
EUR 1394

KLK13 3'UTR Luciferase Stable Cell Line

TU011899 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

KLK13 Rabbit Polyclonal Antibody