셀타젠 Genetic Genotyping

KLK15 Rabbit Polyclonal Antibody

KLK15 Polyclonal Antibody

ES11229-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KLK15 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK15 Rabbit pAb

A2757-100ul 100 ul
EUR 308

KLK15 Rabbit pAb

A2757-200ul 200 ul
EUR 459

KLK15 Rabbit pAb

A2757-20ul 20 ul
EUR 183

KLK15 Rabbit pAb

A2757-50ul 50 ul
EUR 223

KLK15 Antibody

35797-100ul 100ul
EUR 252

KLK15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK15. Recognizes KLK15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

KLK15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK15. Recognizes KLK15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100

KLK15 antibody

70R-KR010 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal KLK15 antibody

Kallikrein 15 (KLK15) polyclonal antibody

ABP-PAB-10212 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:


RA19051 100 ug
EUR 344

KLK15 Conjugated Antibody

C35797 100ul
EUR 397

Anti-KLK15 antibody

STJ24330 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In prostate cancer, this gene has increased expression, which indicates its possible use as a diagnostic or prognostic marker for prostate cancer. The gene contains multiple polyadenylation sites and alternative splicing results in multiple transcript variants encoding distinct isoforms.

Anti-KLK15 Antibody

STJ193188 200 µl
EUR 197

Anti-KLK15 antibody

STJ192387 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KLK15


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK15 cloning plasmid

CSB-CL884452HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atgtggcttctcctcactctctccttcctgctggcatccacagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtctgc
  • Show more
Description: A cloning plasmid for the KLK15 gene.

KLK15 cloning plasmid

CSB-CL884452HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 771
  • Sequence: atgtggcttctcctcactctctccttcctgctggcatccacagcagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtc
  • Show more
Description: A cloning plasmid for the KLK15 gene.

KLK15 cloning plasmid

CSB-CL884452HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 771
  • Sequence: atgtggcttctcctcactctctccttcctgctggcatccacagcagcccaggatggtgacaagttgctggaaggtgacgagtgtgcaccccactcccagccatggcaagtggctctctacgagcgtggacgctttaactgtggcgcttccctcatctccccacactgggtgctgtc
  • Show more
Description: A cloning plasmid for the KLK15 gene.

Human Kallikrein-15 (KLK15) Antibody

35623-05111 150 ug
EUR 261

KLK15 protein (His tag)

80R-3691 100 ug
EUR 327
Description: Purified recombinant KLK15 protein (His tag)

Human KLK15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KLK15 Recombinant Protein (Human)

RP017233 100 ug Ask for price

KLK15 Recombinant Protein (Human)

RP017236 100 ug Ask for price

KLK15 Recombinant Protein (Human)

RP040465 100 ug Ask for price

KLK15 Recombinant Protein (Mouse)

RP146096 100 ug Ask for price

Kallikrein Related Peptidase 15 (KLK15) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein Related Peptidase 15 (KLK15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein Related Peptidase 15 (KLK15) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein Related Peptidase 15 (KLK15) Antibody

abx028332-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Kallikrein Related Peptidase 15 (KLK15) Antibody

abx028332-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human Kallikrein-15 (KLK15) Antibody (Biotin Conjugate)

35623-05121 150 ug
EUR 369

KLK15 ORF Vector (Human) (pORF)

ORF005745 1.0 ug DNA
EUR 95

KLK15 ORF Vector (Human) (pORF)

ORF005746 1.0 ug DNA
EUR 95

KLK15 ORF Vector (Human) (pORF)

ORF013489 1.0 ug DNA
EUR 354

Klk15 ORF Vector (Mouse) (pORF)

ORF048700 1.0 ug DNA
EUR 506

Human Kallikrein-15 (KLK15) AssayLite Antibody (FITC Conjugate)

35623-05141 150 ug
EUR 428

Human Kallikrein-15 (KLK15) AssayLite Antibody (RPE Conjugate)

35623-05151 150 ug
EUR 428

Human Kallikrein-15 (KLK15) AssayLite Antibody (APC Conjugate)

35623-05161 150 ug
EUR 428

Human Kallikrein-15 (KLK15) AssayLite Antibody (PerCP Conjugate)

35623-05171 150 ug
EUR 471

Human Kallikrein- 15, KLK15 ELISA KIT

ELI-46403h 96 Tests
EUR 824

Klk15 sgRNA CRISPR Lentivector set (Mouse)

K4285101 3 x 1.0 ug
EUR 339

KLK15 sgRNA CRISPR Lentivector set (Human)

K1160901 3 x 1.0 ug
EUR 339

KLK15 Kallikrein-15 Human Recombinant Protein

PROTQ9H2R5 Regular: 20ug
EUR 317
Description: KLK15 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 258 amino acids (22-256a.a) and having a molecular mass of 28.2kDa. ;KLK15 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Kallikrein 15(KLK15)ELISA Kit

QY-E02951 96T
EUR 361

Klk15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4285102 1.0 ug DNA
EUR 154

Klk15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4285103 1.0 ug DNA
EUR 154

Klk15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4285104 1.0 ug DNA
EUR 154

KLK15 sgRNA CRISPR Lentivector (Human) (Target 1)

K1160902 1.0 ug DNA
EUR 154

KLK15 sgRNA CRISPR Lentivector (Human) (Target 2)

K1160903 1.0 ug DNA
EUR 154

KLK15 sgRNA CRISPR Lentivector (Human) (Target 3)

K1160904 1.0 ug DNA
EUR 154

KLK15 Protein Vector (Human) (pPB-C-His)

PV022977 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPB-N-His)

PV022978 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPM-C-HA)

PV022979 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPM-C-His)

PV022980 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPB-C-His)

PV022981 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPB-N-His)

PV022982 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPM-C-HA)

PV022983 500 ng
EUR 329

KLK15 Protein Vector (Human) (pPM-C-His)

PV022984 500 ng
EUR 329

KLK15 Protein Vector (Mouse) (pPB-C-His)

PV194798 500 ng
EUR 603

KLK15 Protein Vector (Mouse) (pPB-N-His)

PV194799 500 ng
EUR 603

KLK15 Protein Vector (Mouse) (pPM-C-HA)

PV194800 500 ng
EUR 603

KLK15 Protein Vector (Mouse) (pPM-C-His)

PV194801 500 ng
EUR 603

KLK15 Protein Vector (Human) (pPB-C-His)

PV053953 500 ng
EUR 481

KLK15 Protein Vector (Human) (pPB-N-His)

PV053954 500 ng
EUR 481

KLK15 Protein Vector (Human) (pPM-C-HA)

PV053955 500 ng
EUR 481

KLK15 Protein Vector (Human) (pPM-C-His)

PV053956 500 ng
EUR 481

Recombinant Human KLK15 Protein, His, E.coli-1mg

QP12504-HIS-1mg 1mg
EUR 2757

Recombinant Human KLK15 Protein, His, E.coli-1ug

QP12504-HIS-1ug 1ug
EUR 155

Recombinant Human KLK15 Protein, His, E.coli-20ug

QP12504-HIS-20ug 20ug
EUR 201

Recombinant Human KLK15 Protein, His, E.coli-50ug

QP12504-HIS-50ug 50ug
EUR 1261

Recombinant Human KLK15 Protein, His, E.coli-5ug

QP12504-HIS-EC-5ug 5ug
EUR 155

Recombinant Human KLK15 Protein, His, Insect-5ug

QP12504-HIS-INSECT-5ug 5ug
EUR 201

Klk15 3'UTR Luciferase Stable Cell Line

TU110668 1.0 ml Ask for price

Klk15 3'UTR GFP Stable Cell Line

TU160668 1.0 ml Ask for price

Klk15 3'UTR Luciferase Stable Cell Line

TU206790 1.0 ml Ask for price

Klk15 3'UTR GFP Stable Cell Line

TU256790 1.0 ml Ask for price

KLK15 3'UTR GFP Stable Cell Line

TU061901 1.0 ml
EUR 1394

KLK15 3'UTR Luciferase Stable Cell Line

TU011901 1.0 ml
EUR 1394

KLK15 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711753 1.0 ug DNA
EUR 316

KLK15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711757 1.0 ug DNA
EUR 316

KLK15 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711758 1.0 ug DNA
EUR 316

KLK15 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV711759 1.0 ug DNA
EUR 316

KLK15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV711763 1.0 ug DNA
EUR 316

KLK15 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV711764 1.0 ug DNA
EUR 316

KLK15 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV706545 1.0 ug DNA
EUR 450

KLK15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV706549 1.0 ug DNA
EUR 450

KLK15 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV706550 1.0 ug DNA
EUR 450

KLK15 Human, Kallikrein-15 Human Recombinant Protein, sf9

PROTQ9H2R5-1 Regular: 5ug
EUR 317
Description: KLK15 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 249 amino acids (17-256a.a.) and having a molecular mass of 27.4kDa (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;KLK15 is expressed with a 6 amino acids His tag at C-Terminus and purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

KLK15 Rabbit Polyclonal Antibody